OBJECTIVE: To assess mothers' KAP toward breastfeeding and complementary feeding.
METHODOLOGY: A cross-sectional study of 200 mothers with 18- to 24-month-old children at six suburban health clinics in Malaysia. Data were collected via a self-explanatory questionnaire and analyzed using descriptive statistics, chi-square, and Spearman's Rho.
RESULTS: Most mothers had good KAP: 72.5 % had good knowledge, 75.5 % had a positive attitude, and 87 % had good practice. Factors such as maternal age (30-39), multiparity, and vaginal delivery were associated with KAP. Significant positive correlations were found between knowledge and attitude (r = 0.591) and attitude and practice (r = 0.525).
CONCLUSIONS: Continued education on breastfeeding and complementary feeding is essential for improving infant feeding practice, and enhancing child development, potentially reducing healthcare costs.
AIM: The objective of this study was to assess the impact of ethyl acetate extract of fungus comb (EAEFC) on the inflammatory reaction in the spleen of mice induced by intraperitoneal injection of lipopolysaccharide (LPS).
METHODS: An experimental study was conducted using a post-test-only control group design with male BALB/C mice (n = 24). The mice were divided randomly into four groups, each comprising six mice, and administered substances via gavage. Groups I and III were administered a solution of 5% dimethyl sulfoxide (DMSO) in distilled water, while Groups II and IV were given 500 mg/kg BW EAEFC dissolved in 5% DMSO. On the fifteenth day, Groups I and II received intraperitoneal injections of 5 ml/kg BW saline, while Groups III and IV were injected with 10 mg/kg BW LPS dissolved in saline. After three hours, the mice were euthanized and splenic immunohistology was examined under a light microscope. The results were expressed as mean ± standard deviation, while the group differences were assessed statistically.
RESULTS: The expression of interleukin (IL)-1, furin, and activated NK cell was significantly higher in the inflamed model after EAEFC supplementation, while the extract suppressed IL-10.
CONCLUSION: EAEFC was found to alter cytokine expression in the spleen in response to inflammation.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.
AIM: This study evaluates the local and systemic biocompatibility of IVD in five non-pregnant female cats.
METHODS: The IVD was successfully inserted into the vaginal lumen after estrogen administration. Radiographic imaging confirmed the IVD's position, which lasted up to two days post-insertion.
RESULTS: Systemic response, assessed through hematological examinations on days 0, 1, and 3 post-insertion, showed no significant changes in erythrogram and leukogram parameters. Local response, evaluated through vulvar inspection and vaginal cytology on days 0, 1, 3, and 7, revealed no neutrophil infiltration in 4 out of 5 cats, indicating compatibility with vaginal tissue. Furthermore, epithelial cell profile changes were observed, showing an increase in superficial cells, which is typical during the estrus phase.
CONCLUSION: These findings suggest that the IVD is biocompatible and suitable for use as a contraceptive and identity device in cats. However, further long-term studies are necessary to evaluate the device's prolonged efficacy and potential for contraception failure prevention by mating trials.
OBJECTIVE: The aim of this study was to evaluate the clinical effects and accuracy of three-dimensionally (3D)-printed patient-specific surgical plates used for mandibular defect reconstruction.
METHODS: This study included patients who underwent mandibular defect reconstruction with vascularized autogenous bone grafts between January 2012 and August 2021. They were divided into experimental (fixation with 3D-printed surgical plates) and control (fixation with conventional surgical plates) groups. Flap survival rate, postoperative complications and patient self-evaluated facial appearance were compared. Mandibular reconstruction accuracy evaluation included postoperative position deviation of the whole mandible, transplanted bone graft, lower mandibular border, mandibular condyle, and mandibular angle on the reconstructed side compared to baseline.
RESULTS: This study included 20 patients (14 males, six females; age, 39.45 ± 11.69 years), ten each in the experimental and control groups. The mean follow-up was 16 ± 22.05 (range, 6-99) months. All procedures were successful, no plate-related complications (breakage, loosening, or exposure of the surgical plates) were reported, and all patients were satisfied. The groups were statistically similar in th e position deviation of the whole mandible, transplanted bone graft, mandibular condyle, and mandibular angle, but the position and morphology of the lower mandibular border on the reconstructed side in the experimental group were better than those in the control group (P = 0.016).
CONCLUSIONS: 3D-printed patient-specific surgical plates could be applied in mandibular reconstruction safely and effectively, simplifying the surgical procedure, shortening the preoperative preparation times, achieving satisfactory outcomes, and improving the clinical effects and accuracy of individualized mandibular reconstruction.
METHODS: This study employed genomic methodologies to investigate the correlation between drug sensitivity and types of AICD in BC. Initially, data from TCGA were utilized to construct a prognostic model and classification system for AICD. Subsequently, a series of bioinformatics analyses assessed the prognostic and clinical significance of this model within the context of BC.
RESULTS: Analysis revealed a cohort of 18 genes associated with AICD, exhibiting prognostic relevance. Survival analyses indicated that overall survival rates were significantly lower in high-risk populations compared to their low-risk counterparts. Furthermore, prognostic indicators linked to AICD demonstrated high accuracy in predicting survival outcomes in BC. Immunological assessments indicated heightened expression of anti-tumor infiltrating immune cells and immune checkpoint molecules in low-risk populations, correlating with various anti-tumor immune functions. Ultimately, a comprehensive prognostic model related to AICD was developed through univariate analysis, least absolute shrinkage and selection operator (LASSO), and multivariate Cox regression analysis. As Adenosine triphosphate (ATP) concentration increased, the viability of BC cells exhibited a general decline at each time point. Notably, ATP diminished the mitochondrial membrane potential in BC cells while enhancing it in normal breast epithelial cells. Additionally, ATP inhibited the migration of BC cells and promoted their apoptosis. ATP also stimulated reactive oxygen species (ROS) production in MCF-10A cells, with implications for the immune response in BC cells. Compared to the control group, expression levels of CLIC6, SLC1A1, and CEMIP were significantly reduced in the ATP intervention group, whereas ANO6 expression was elevated. ANO6, CEMIP, and CLIC6 share genetic variants with BC, while SLC1A1 does not exhibit genetic causal variation with the disease.
CONCLUSION: A valuable prognostic model associated with AICD has been established, capable of accurately predicting BC prognosis. The induction of cell death by ATP appears to play a protective role in BC progression. These findings carry significant implications for the implementation of personalized and tailored treatment strategies for BC patients.
METHODS: We searched PubMed, Embase, and Web of Science through August 2024 for randomized controlled trials evaluating ensifentrine in COPD patients over a minimum of four weeks. Data extraction and screening utilized Knowledge software, and meta-analyses were performed using R v4.4 with a random-effects model.
RESULTS: From 206 studies identified, four met our inclusion criteria. Ensifentrine improved FEV1 significantly at a dose of 3 mg (LS mean difference: 40.90 mL; 95% CI: 19.65-62.15). It also improved dyspnea as measured by the Transition Dyspnea Index (TDI) (LS mean difference: 0.91; 95% CI: 0.61-1.21) and quality of life according to the St. George's Respiratory Questionnaire-C (SGRQ-C) scores (LS mean difference: -1.92; 95% CI: -3.28 to -0.55). Safety profiles were comparable between the ensifentrine and placebo groups, with no significant increase in treatment-emergent adverse events (TEAEs) (RR: 1.02; 95% CI: 0.94-1.10).
CONCLUSION: Ensifentrine significantly enhances lung function, reduces dyspnea, and improves quality of life in COPD patients, especially at a 3 mg dose. These benefits, coupled with a stable safety profile, support its use as an adjunctive therapy in COPD management.