Browse publications by year: 2024

  1. Jalil H, Chong MC, Jalaludin MY, Wong LP, Hmwe NTT
    Heliyon, 2024 Nov 15;10(21):e39746.
    PMID: 39553637 DOI: 10.1016/j.heliyon.2024.e39746
    BACKGROUND: Breastfeeding for the first six months and complementary feeding until twelve months are crucial for child growth. A mother's knowledge, attitude, and practice (KAP) on infant feeding significantly impact infant development.

    OBJECTIVE: To assess mothers' KAP toward breastfeeding and complementary feeding.

    METHODOLOGY: A cross-sectional study of 200 mothers with 18- to 24-month-old children at six suburban health clinics in Malaysia. Data were collected via a self-explanatory questionnaire and analyzed using descriptive statistics, chi-square, and Spearman's Rho.

    RESULTS: Most mothers had good KAP: 72.5 % had good knowledge, 75.5 % had a positive attitude, and 87 % had good practice. Factors such as maternal age (30-39), multiparity, and vaginal delivery were associated with KAP. Significant positive correlations were found between knowledge and attitude (r = 0.591) and attitude and practice (r = 0.525).

    CONCLUSIONS: Continued education on breastfeeding and complementary feeding is essential for improving infant feeding practice, and enhancing child development, potentially reducing healthcare costs.

  2. Bognár A, Borkhanuddin MH, Nagase S, Sellyei B
    PeerJ, 2024;12:e18288.
    PMID: 39553726 DOI: 10.7717/peerj.18288
    Ectoparasites cause serious problems during the aquaculture production of food fishes. In this study, we set out to develop and test protocols for maintenance and sampling European catfish (Silurus glanis L., 1758) stocks infected with a gill monogenean, Thaparocleidus vistulensis (Siwak 1932) Lim 1996. When we compared the feasibility of two cohabitation-based parasite culture systems (i.e., static vs. flow-through), we found that the life cycle of T. vistulensis was completed in both habitats. In our experience, static tank systems with regular water exchange allowed better daily quality control of the parasite culture than continuous flow-through systems. We investigated the microhabitat preference of T. vistulensis on the gills of infected European catfish. A balanced distribution on the two lateral gill sets and a decreasing trend in parasite numbers from anterior gill holobranches towards the posterior ones was observed. Using these results, we developed a minimally invasive sampling protocol to estimate the parasite load of individuals. The biopsy aimed at four sectors (#6, #7, #10, and #11) situated within the distal and middle zones of the first holobranch on the left side, encompassing both rows of filaments. Biopsy-based estimates of parasite loads were validated by comparing them to full parasite counts of the same individuals and showed statistically significant correlations. Our biopsy-based method is designed to identify experimental animals with similar parasite loads and create groups of hosts with comparable burdens. This setup is expected to generate reduced between-group differences for expensive experiments (e.g., high throughput transcriptomic or epigenetic studies). We propose that the biopsy-based pre-sorting procedure should be considered in similar experiments with other cultured fish species and their gill monogeneans following a thorough fine-tuning of the experimental conditions.
    MeSH terms: Animals; Biopsy/methods; Trematoda/physiology; Trematode Infections/parasitology; Trematode Infections/veterinary; Aquaculture/methods; Parasite Load
  3. Susanto H, Sudiana K, Nandika D, Karlinasari L, Arinana A, Karim SA, et al.
    Open Vet J, 2024 Sep;14(9):2269-2279.
    PMID: 39553755 DOI: 10.5455/OVJ.2024.v14.i9.15
    BACKGROUND: The fungus comb is a unique structure inside termites' nests that facilitates the growth of Termitomyces sp. as a nutrient source for the termites. It is known to possess immunomodulatory properties that boost the immune system.

    AIM: The objective of this study was to assess the impact of ethyl acetate extract of fungus comb (EAEFC) on the inflammatory reaction in the spleen of mice induced by intraperitoneal injection of lipopolysaccharide (LPS).

    METHODS: An experimental study was conducted using a post-test-only control group design with male BALB/C mice (n = 24). The mice were divided randomly into four groups, each comprising six mice, and administered substances via gavage. Groups I and III were administered a solution of 5% dimethyl sulfoxide (DMSO) in distilled water, while Groups II and IV were given 500 mg/kg BW EAEFC dissolved in 5% DMSO. On the fifteenth day, Groups I and II received intraperitoneal injections of 5 ml/kg BW saline, while Groups III and IV were injected with 10 mg/kg BW LPS dissolved in saline. After three hours, the mice were euthanized and splenic immunohistology was examined under a light microscope. The results were expressed as mean ± standard deviation, while the group differences were assessed statistically.

    RESULTS: The expression of interleukin (IL)-1, furin, and activated NK cell was significantly higher in the inflamed model after EAEFC supplementation, while the extract suppressed IL-10.

    CONCLUSION: EAEFC was found to alter cytokine expression in the spleen in response to inflammation.

    MeSH terms: Animals; Inflammation/chemically induced; Inflammation/drug therapy; Lipopolysaccharides/administration & dosage; Lipopolysaccharides/pharmacology; Male; Mice, Inbred BALB C*; Mice; Termitomyces/chemistry
  4. Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    MeSH terms: Red Meat/analysis; Animals; Cattle; Food Contamination/analysis; Meat/analysis; Meat Products/analysis; Sensitivity and Specificity; Rats
  5. Santoso MIB, Ainun SS, Utami D, Aziz FA, Puspitaningsih R, Ashar Y, et al.
    Open Vet J, 2024 Sep;14(9):2348-2360.
    PMID: 39553770 DOI: 10.5455/OVJ.2024.v14.i9.23
    BACKGROUND: An intravaginal device (IVD) made from polyethylene plastic and copper wire, integrated with a radio frequency identification (RFID) chip, was developed as a biocompatible contraceptive and identity device for cats.

    AIM: This study evaluates the local and systemic biocompatibility of IVD in five non-pregnant female cats.

    METHODS: The IVD was successfully inserted into the vaginal lumen after estrogen administration. Radiographic imaging confirmed the IVD's position, which lasted up to two days post-insertion.

    RESULTS: Systemic response, assessed through hematological examinations on days 0, 1, and 3 post-insertion, showed no significant changes in erythrogram and leukogram parameters. Local response, evaluated through vulvar inspection and vaginal cytology on days 0, 1, 3, and 7, revealed no neutrophil infiltration in 4 out of 5 cats, indicating compatibility with vaginal tissue. Furthermore, epithelial cell profile changes were observed, showing an increase in superficial cells, which is typical during the estrus phase.

    CONCLUSION: These findings suggest that the IVD is biocompatible and suitable for use as a contraceptive and identity device in cats. However, further long-term studies are necessary to evaluate the device's prolonged efficacy and potential for contraception failure prevention by mating trials.

    MeSH terms: Administration, Intravaginal; Animals; Biocompatible Materials/administration & dosage; Cats; Contraception/instrumentation; Contraception/methods; Contraception/veterinary; Contraceptive Devices, Female/veterinary; Female; Vagina/drug effects; Radio Frequency Identification Device*
  6. Zhang WB, Wang CF, Yu Y, Liu S, Hu LH, Soh HY, et al.
    PMID: 39553818 DOI: 10.1177/19433875241272441
    STUDY DESIGN: Prospective and retrospective studies.

    OBJECTIVE: The aim of this study was to evaluate the clinical effects and accuracy of three-dimensionally (3D)-printed patient-specific surgical plates used for mandibular defect reconstruction.

    METHODS: This study included patients who underwent mandibular defect reconstruction with vascularized autogenous bone grafts between January 2012 and August 2021. They were divided into experimental (fixation with 3D-printed surgical plates) and control (fixation with conventional surgical plates) groups. Flap survival rate, postoperative complications and patient self-evaluated facial appearance were compared. Mandibular reconstruction accuracy evaluation included postoperative position deviation of the whole mandible, transplanted bone graft, lower mandibular border, mandibular condyle, and mandibular angle on the reconstructed side compared to baseline.

    RESULTS: This study included 20 patients (14 males, six females; age, 39.45 ± 11.69 years), ten each in the experimental and control groups. The mean follow-up was 16 ± 22.05 (range, 6-99) months. All procedures were successful, no plate-related complications (breakage, loosening, or exposure of the surgical plates) were reported, and all patients were satisfied. The groups were statistically similar in th e position deviation of the whole mandible, transplanted bone graft, mandibular condyle, and mandibular angle, but the position and morphology of the lower mandibular border on the reconstructed side in the experimental group were better than those in the control group (P = 0.016).

    CONCLUSIONS: 3D-printed patient-specific surgical plates could be applied in mandibular reconstruction safely and effectively, simplifying the surgical procedure, shortening the preoperative preparation times, achieving satisfactory outcomes, and improving the clinical effects and accuracy of individualized mandibular reconstruction.

  7. Han C, Zhai C, Li A, Ma Y, Hallajzadeh J
    Front Cardiovasc Med, 2024;11:1432468.
    PMID: 39553846 DOI: 10.3389/fcvm.2024.1432468
    Myocardial infarction (MI), a widespread cardiovascular issue, mainly occurs due to blood clot formation in the coronary arteries, which reduces blood flow to the heart muscle and leads to cell death. Incorporating exercise into a lifestyle can significantly benefit recovery and reduce the risk of future cardiac events for MI patients. Non-coding RNAs (ncRNAs) play various roles in the effects of exercise on myocardial infarction (MI). ncRNAs regulate gene expression, influence cardiac remodeling, angiogenesis, inflammation, oxidative stress, apoptosis, cardioprotection, and cardiac electrophysiology. The expression of specific ncRNAs is altered by exercise, leading to beneficial changes in heart structure, function, and recovery after MI. These ncRNAs modulate molecular pathways that contribute to improved cardiac health, including reducing inflammation, enhancing angiogenesis, promoting cell survival, and mitigating oxidative stress. Furthermore, they are involved in regulating changes in cardiac remodeling, such as hypertrophy and fibrosis, and can influence the electrical properties of the heart, thereby decreasing the risk of arrhythmias. Knowledge on MI has entered a new phase, with investigations of ncRNAs in physical exercise yielding invaluable insights into the impact of this therapeutic modality. This review compiled research on ncRNAs in MI, with an emphasis on their applicability to physical activity.
  8. Dobhal S, Hugouvieux-Cotte-Pattat N, Arizala D, Sari GB, Chuang SC, Alvarez AM, et al.
    bioRxiv, 2024 Oct 30.
    PMID: 39554176 DOI: 10.1101/2024.10.29.620964
    Recently, species clustering within Dickeya zeae has been identified as complex, encompassing validly published names, including D. oryzae and D. parazeae, with some strains potentially delineating new species. In this study, genomes of strains isolated from a bacterial heart rot outbreak in pineapple (Ananas comosus var. comosus) on Oahu, Hawaii, along with two strains from pineapple in Malaysia, were sequenced. Orthologous average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values among the sequenced genomes ranged from 98.93-99.9% and 91.8-99.9%, respectively, supporting the classification of seven strains within the same species. Comparisons of ANI and dDDH values between these seven strains and type strains of D. zeae, D. parazeae, and D. oryzae ranged from 94.4-95.9% and 57.2-66.5%, respectively. These values fall below the proposed boundaries for new species designation, supporting the delineation of a novel species. Phylogenetic analyses, including 16S rRNA, gapA, multi-locus sequence analysis (MLSA) of 10 housekeeping genes, whole-genome, and pangenome analyses, were concordant and revealed a distinct monophyletic clade, separating these strains from other members of the D. zeae complex, with D. oryzae as the closest relative. Notably, a nitrogen fixation gene cluster comprising 28 genes, similar to the Klebsiella spp. nitrogenase gene cluster, was found in the genome of the seven pineapple strains. Based on polyphasic approaches, including ANI, dDDH, biochemical, physiological, and phylogenomic analyses, we propose the reclassification in a new species of the five pineapple strains from Hawaii A5391, A5410T, A5611, A6136, and A6137, together with the two pineapple strains from Malaysia CFBP 1272 and CFBP 1278, previously classified as D. zeae. We propose the name Dickeya ananae sp. nov. for this taxon, represented by the type strain A5410T (= ICMP 25020T = LMG 33197T).
  9. Qiu W, Wang Z, Liu Q, Du Q, Zeng X, Wu Z, et al.
    Food Sci Nutr, 2024 Sep;12(9):6055-6069.
    PMID: 39554349 DOI: 10.1002/fsn3.4228
    The number of patients with inflammatory bowel disease (IBD) is increasing worldwide. Since IBD is a chronic disease that seriously affects patients' life quality, preventing and alleviating IBD with natural and less side effect substances has become a research hotspot. Food-derived bioactive peptides have been an attractive research focus due to their high efficiency and low toxicity. This paper comprehensively summarizes food-derived peptides with intestinal health effects, focusing on peptide sequences with IBD-regulatory effects and emphasizing the effects of their structure and physicochemical properties such as peptide length, amino acid composition, and net charge on their function. We also analyzed its regulatory mechanisms, mainly in 5 aspects: modulating the intestinal microbiota, decreasing intestinal epithelial permeability, increasing antioxidant ability, regulating the expression of inflammatory cytokines, and targeting signaling pathways. This review will help establish novel, efficient screening methods for IBD-regulatory peptides and contribute to further research and discovery of them.
  10. Ab Razak S, Zainal-Abidin RA, Mohd Ikmal A, Mohd-Assaad N, Abd Aziz Shamsudin N
    Data Brief, 2024 Dec;57:111051.
    PMID: 39554550 DOI: 10.1016/j.dib.2024.111051
    The genomics and genetic information of Malaysian rice (Oryza sativa L.) is currently limited. It was necessary to conduct genome resequencing of these rice accessions exhibiting different responses to salinity stress. The sequencing was carried out using the Illumina NovaSeq X platform with 30× sequencing coverage to pinpoint variants between salinity tolerant and sensitive rice accessions. The discovery of single nucleotide polymorphisms (SNPs) is crucial for the development of DNA markers associated with salinity tolerance traits. The genome sequence data (FASTQ format) for these accessions have been deposited to the European Nucleotide Archive (ENA) database under the accession number PRJEB71716.
  11. Fathima AM, Rahmawati L, Windarsih A, Suratno
    Food Sci Anim Resour, 2024 Nov;44(6):1195-1212.
    PMID: 39554825 DOI: 10.5851/kosfa.2024.e75
    Religious beliefs have a significant impact on consumer preferences, particularly in relation to food choices. Islam, like other religions, imposes specific dietary guidelines, notably regarding meat and meat products. However, ensuring compliance with halal standards across the entire meat and meat products supply chain presents considerable challenges. Instances of non-compliance, including improper slaughtering techniques, mislabeling, adulteration, and contamination, have caused concerns about the authenticity of halal status. To address these concerns, this review explores recent advancements in halal authentication methods and technology, focusing on practical objectives aimed at addressing non-compliance issues. It categorizes methods into four main areas of non-compliance concerns, providing a unique perspective compared to earlier reviews that primarily examined the progression of analytical methods. This classification offers a comprehensive analysis of the field's current status, facilitating the identification of research gaps and strategic recommendations for enhancing future halal authentication methods. Through the implementation of this novel approach, the review seeks to promote the development of a more robust framework for evaluating halal meat and meat products, safeguarding consumer trust and ensuring adherence to religious dietary guidelines in the future.
  12. Zhang Z, Zhang H, Zhang Z, Sandai D, Lu P, Zhang H, et al.
    Front Immunol, 2024;15:1483498.
    PMID: 39555060 DOI: 10.3389/fimmu.2024.1483498
    BACKGROUND: Cell death mechanisms are integral to the pathogenesis of breast cancer (BC), with ATP-induced cell death (AICD) attracting increasing attention due to its distinctive specificity and potential therapeutic applications.

    METHODS: This study employed genomic methodologies to investigate the correlation between drug sensitivity and types of AICD in BC. Initially, data from TCGA were utilized to construct a prognostic model and classification system for AICD. Subsequently, a series of bioinformatics analyses assessed the prognostic and clinical significance of this model within the context of BC.

    RESULTS: Analysis revealed a cohort of 18 genes associated with AICD, exhibiting prognostic relevance. Survival analyses indicated that overall survival rates were significantly lower in high-risk populations compared to their low-risk counterparts. Furthermore, prognostic indicators linked to AICD demonstrated high accuracy in predicting survival outcomes in BC. Immunological assessments indicated heightened expression of anti-tumor infiltrating immune cells and immune checkpoint molecules in low-risk populations, correlating with various anti-tumor immune functions. Ultimately, a comprehensive prognostic model related to AICD was developed through univariate analysis, least absolute shrinkage and selection operator (LASSO), and multivariate Cox regression analysis. As Adenosine triphosphate (ATP) concentration increased, the viability of BC cells exhibited a general decline at each time point. Notably, ATP diminished the mitochondrial membrane potential in BC cells while enhancing it in normal breast epithelial cells. Additionally, ATP inhibited the migration of BC cells and promoted their apoptosis. ATP also stimulated reactive oxygen species (ROS) production in MCF-10A cells, with implications for the immune response in BC cells. Compared to the control group, expression levels of CLIC6, SLC1A1, and CEMIP were significantly reduced in the ATP intervention group, whereas ANO6 expression was elevated. ANO6, CEMIP, and CLIC6 share genetic variants with BC, while SLC1A1 does not exhibit genetic causal variation with the disease.

    CONCLUSION: A valuable prognostic model associated with AICD has been established, capable of accurately predicting BC prognosis. The induction of cell death by ATP appears to play a protective role in BC progression. These findings carry significant implications for the implementation of personalized and tailored treatment strategies for BC patients.

    MeSH terms: Female; Humans; Prognosis; RNA, Messenger/genetics; RNA, Messenger/metabolism; Biomarkers, Tumor/genetics; Gene Expression Regulation, Neoplastic; Cell Death/genetics; Apoptosis; Gene Expression Profiling; Cell Line, Tumor; Transcriptome
  13. Dogan S, Barua PD, Baygin M, Tuncer T, Tan RS, Ciaccio EJ, et al.
    Cogn Neurodyn, 2024 Oct;18(5):2503-2519.
    PMID: 39555305 DOI: 10.1007/s11571-024-10104-1
    This paper presents an innovative feature engineering framework based on lattice structures for the automated identification of Alzheimer's disease (AD) using electroencephalogram (EEG) signals. Inspired by the Shannon information entropy theorem, we apply a probabilistic function to create the novel Lattice123 pattern, generating two directed graphs with minimum and maximum distance-based kernels. Using these graphs and three kernel functions (signum, upper ternary, and lower ternary), we generate six feature vectors for each input signal block to extract textural features. Multilevel discrete wavelet transform (MDWT) was used to generate low-level wavelet subbands. Our proposed model mirrors deep learning approaches, facilitating feature extraction in frequency and spatial domains at various levels. We used iterative neighborhood component analysis to select the most discriminative features from the extracted vectors. An iterative hard majority voting and a greedy algorithm were used to generate voted vectors to select the optimal channel-wise and overall results. Our proposed model yielded a classification accuracy of more than 98% and a geometric mean of more than 96%. Our proposed Lattice123 pattern, dynamic graph generation, and MDWT-based multilevel feature extraction can detect AD accurately as the proposed pattern can extract subtle changes from the EEG signal accurately. Our prototype is ready to be validated using a large and diverse database.
  14. Saputra I, Lee YN, Fotedar R
    Aquac Nutr, 2024;2024:8579991.
    PMID: 39555534 DOI: 10.1155/2024/8579991
    The present study aims to evaluate the effect of liquid fish protein hydrolysate (FPH) following fishmeal substitution with full-fat and defatted BSF (black soldier fly, Hermetia illucens) meal in the feeds of juvenile ornate spiny lobster, Panulirus ornatus. The physiological aspects of juvenile lobsters including growth, fatty acids profile, and histopathology were observed. Six isoenergetic experimental feeds having a protein-to-energy ratio of 26 CP mg kJ-1 were formulated with the substitution of fishmeal at 25% using liquid FPH, full-fat BSF (FBSF), defatted BSF (DBSF), and their combination. The specific growth rate, final body weight, final total length, and length increment of juvenile lobsters (initial weight was 0.21 ± 0.01 g and total length was 20.53 ± 0.12 mm) were significantly affected by the fishmeal substitution (P  < 0.05) and improved with the addition of liquid FPH in the feeds containing FBSF and DBSF. The whole body proximate analysis showed that the liquid FPH to the feeds containing DBSF increased the ash and protein content significantly (P  < 0.05). The total monounsaturated fatty acids (∑MUFA), saturated fatty acids (∑SFA), and omega 9 fatty acids (∑n-9 FA) of juvenile lobsters' whole bodies fed with dietary DBSF and FPH supplementation were significantly higher than those of others (P  < 0.05). The histopathological analysis indicated that the villus size and the muscle thickness in the intestine were not significantly affected by FPH supplementation. However, the hepatopancreas histopathology indicated the presence of B-cells and R-cells in the juvenile lobsters fed with FPH-supplemented feeds. The present results suggested the supplementation of liquid FPH to the formulated feed with FBSF and DBSF for juvenile lobsters can improve the lobsters' growth and fatty acids availability.
  15. Mohd Nor NH, Mansor NI, Hasim NA
    Tissue Eng Part B Rev, 2024 Nov 18.
    PMID: 39556233 DOI: 10.1089/ten.teb.2024.0216
    In the realm of dental tissue regeneration research, various constraints exist such as the potential variance in cell quality, potency arising from differences in donor tissue and tissue microenvironment, the difficulties associated with sustaining long-term and large-scale cell expansion while preserving stemness and therapeutic attributes, as well as the need for extensive investigation into the enduring safety and effectiveness in clinical settings. The adoption of artificial intelligence (AI) technologies has been suggested as a means to tackle these challenges. This is because, tissue regeneration research could be advanced through the use of diagnostic systems that incorporate mining methods such as neural networks (NN), fuzzy, predictive modeling, genetic algorithms, machine learning (ML), cluster analysis, and decision trees. This article seeks to offer foundational insights into a subset of AI referred to as artificial neural networks (ANNs) and assess their potential applications as essential decision-making support tools in the field of dentistry, with a particular focus on tissue engineering research. Although ANNs may initially appear complex and resource intensive, they have proven to be effective in laboratory and therapeutic settings. This expert system can be trained using clinical data alone, enabling their deployment in situations where rule-based decision-making is impractical. As ANNs progress further, it is likely to play a significant role in revolutionizing dental tissue regeneration research, providing promising results in streamlining dental procedures and improving patient outcomes in the clinical setting.
  16. Athul S, Kuttippurath J, Patel VK
    J Hazard Mater, 2024 Nov 13;481:136482.
    PMID: 39556909 DOI: 10.1016/j.jhazmat.2024.136482
    Severe restrictions on human travel and consumption during the lockdown (LD) have affected global marine traffic and operations. The LD period is ideal for studying the emissions as there were restricted human activities. Although several pollutants are emitted by ships, the most important is nitrogen dioxide (NO2), and can be considered an indicator of shipping emissions. Therefore, we examine the changes in NO2 pollution over the shipping lanes, ports and coasts across the globe during LD. Here, we find a significant decline in NO2 during LD over the major lanes, including the USA-Europe trade routes through the North Atlantic Ocean, Asia-Middle East through the Arabian Sea, Interasia, and Intereuropean through the North Sea and Baltic Sea, about 10-20%, as analysed form the TROPOMI satellite measurements. A similar reduction over the sea straight pass, such as the Cape of Good Hope and the Strait of Malacca is also estimated. Furthermore, the major global ports of Callao, Santos, Antwerp, Rotterdam, Busan, Tubarao, Richards Bay, Barcelona, Durban and Chennai exhibit a significant decrease in NO2 during LD, about 30%. The decline in NO2 over the shipping routes and ports can be attributed to reduced cargo, passenger, fishing and tanker vessel density due to the LD restrictions; consistent with the emission inventory analysis. Henceforth, this study suggests strict environmental policies in the shipping sector to curb emissions, as pollution is a great concern for public health in the port cities and coastal regions.
  17. Li HB, Huang L, Ni JY, Lin RY, Xi SY
    Phytomedicine, 2024 Dec;135:156244.
    PMID: 39556987 DOI: 10.1016/j.phymed.2024.156244
    Primary hepatic carcinoma is one of the most common malignant tumors. China is a major country for liver cancer, accounting for about 50 % of the patients worldwide. Although there are a variety of treatments for primary hepatic carcinoma, chemotherapy remains an important method, and transcatheter arterial chemoembolization (TACE) is a commonly used local chemotherapy. Currently, there are no effective therapeutic measures to target adverse reactions generated after chemoembolization. A new approach is needed to alleviate post-TACE syndrome. Clinical and experimental studies have shown that traditional Chinese medicine can reduce adverse reactions and improve clinical efficacy when combined with primary hepatic carcinoma treatment. This suggests that traditional Chinese medicine plays an important and irreplaceable role in alleviating adverse reactions after TACE. However, there is still a need for high-quality experimental and clinical studies to obtain evidence of effective treatment.
    MeSH terms: Humans; Medicine, Chinese Traditional*
  18. Yappalparvi A, Balaraman AK, Padmapriya G, Gaidhane S, Kaur I, Lal M, et al.
    Respir Med, 2024 Nov 16.
    PMID: 39557208 DOI: 10.1016/j.rmed.2024.107863
    BACKGROUND: Chronic obstructive pulmonary disease (COPD) significantly impacts global health due to persistent airflow limitation and inflammation. Despite standard therapies, symptoms persist. Ensifentrine, targeting both bronchoconstriction and inflammation as a dual phosphodiesterase 3 and 4 inhibitor, offers a promising therapeutic advancement for COPD management. This meta-analysis evaluates the safety and efficacy of ensifentrine in improving lung function, dyspnea, and quality of life in COPD patients.

    METHODS: We searched PubMed, Embase, and Web of Science through August 2024 for randomized controlled trials evaluating ensifentrine in COPD patients over a minimum of four weeks. Data extraction and screening utilized Knowledge software, and meta-analyses were performed using R v4.4 with a random-effects model.

    RESULTS: From 206 studies identified, four met our inclusion criteria. Ensifentrine improved FEV1 significantly at a dose of 3 mg (LS mean difference: 40.90 mL; 95% CI: 19.65-62.15). It also improved dyspnea as measured by the Transition Dyspnea Index (TDI) (LS mean difference: 0.91; 95% CI: 0.61-1.21) and quality of life according to the St. George's Respiratory Questionnaire-C (SGRQ-C) scores (LS mean difference: -1.92; 95% CI: -3.28 to -0.55). Safety profiles were comparable between the ensifentrine and placebo groups, with no significant increase in treatment-emergent adverse events (TEAEs) (RR: 1.02; 95% CI: 0.94-1.10).

    CONCLUSION: Ensifentrine significantly enhances lung function, reduces dyspnea, and improves quality of life in COPD patients, especially at a 3 mg dose. These benefits, coupled with a stable safety profile, support its use as an adjunctive therapy in COPD management.

  19. Omoregie AI, Alhassan M, Ouahbi T
    Int J Biol Macromol, 2024 Nov 16;283(Pt 2):137770.
    PMID: 39557263 DOI: 10.1016/j.ijbiomac.2024.137770
    Lilium spp. polysaccharides (LSPs) are gaining significant attention for their diverse health benefits, including antioxidant, antitumor, and antibacterial properties. This paper critically analyzes a recent comprehensive review by Li et al., published in International Journal of Biological Macromolecules, focusing on LSP extraction, purification, and health benefits. While the original review offers valuable insights, this critique identifies opportunities to strengthen the bibliometric analysis section. This study employs a comprehensive search strategy in Scopus using specific keywords and covering a broader time frame (1975-2023), revealing 94 research articles on LSPs. The critique proposes improvements to enhance transparency and impact, such as specifying search queries and Boolean operators used across databases, detailing selection criteria, and incorporating advanced analyses. This article discusses author keyword analysis, co-citation analysis of cited authors, and bibliographic coupling analysis of documents using VOSviewer software. The global landscape mapping of LSP relationships involving authors, countries, and keywords was determined using RStudio software. These refinements will provide a more robust foundation for understanding the LSP research landscape and future research directions while also addressing common pitfalls and suggesting improvements in bibliometric analysis for future studies.
  20. Deng X, Yang Z, Han M, Ismail N, Esa NM, Razis AFA, et al.
    Phytother Res, 2024 Nov 18.
    PMID: 39557422 DOI: 10.1002/ptr.8378
    Despite the advancement in cancer diagnosis and treatment, colorectal cancer remains the leading cause of cancer-related death worldwide. Given the high recurrence rate of colorectal cancer even after surgical resection, chemotherapy has been clinically used to improve the treatment outcomes of colorectal cancer. However, chemotherapy is well-known for its toxic side effects. Thus, phytochemicals have been widely studied in recent years as preventive and therapeutic agents for colorectal cancer owing to their relatively low toxicity. Moreover, combinatorial uses of phytochemicals with other natural compounds or with drugs may amplify the positive outcomes of colorectal cancer prevention and treatment by intervening in multiple signaling pathways and targets. This review summarized the combinatorial use of several well-studied groups of phytochemicals, that is, isothiocyanates, quinones, carotenoids, and alkaloids, in the prevention and treatment of colorectal cancer, and suggested it as a potential approach to improve the anticancer efficacy of single compounds and minimize the toxic side effects associated with conventional drugs. Notably, we generalized the in vitro, in vivo, and clinical experiments-based molecular mechanisms whereby the selected phytochemicals in combination with other compounds exerted anti-colorectal cancer effects by inhibiting cancer cell proliferation, cell apoptosis, cell invasion, and tumor growth. Overall, this review provides a reference and new perspective to propel further advancements in research and development of preventative and therapeutic strategies for colorectal cancer.
External Links