MyMedR

Displaying all 15 publications

Abstract:

Sort:

Family with hereditary persistence of foetal haemoglobin

Boon WH

Med J Malaya, 1968 Sep;23(1):61-6.
PMID: 4237561
Matched MeSH terms: Hemoglobinopathies/genetics*
Fulltext The International Hemoglobinopathy Research Network (INHERENT): An international initiative to study the role of genetic modifiers in hemoglobinopathies

Kountouris P, Stephanou C, Archer N, Bonifazi F, Giannuzzi V, Kuo KHM, et al.

Am J Hematol, 2021 Nov 01;96(11):E416-E420.
PMID: 34406671 DOI: 10.1002/ajh.26323
Matched MeSH terms: Hemoglobinopathies/genetics*
Fusion genes in malignant neoplastic disorders of haematopoietic system

Saleem M, Yusoff NM

Hematology, 2016 Oct;21(9):501-12.
PMID: 26871368 DOI: 10.1080/10245332.2015.1106816

OBJECTIVES: The new World Health Organization's (WHO) classification of haematopoietic and lymphoid tissue neoplasms incorporating the recurrent fusion genes as the defining criteria for different haematopoietic malignant phenotypes is reviewed. The recurrent fusion genes incorporated in the new WHO's classification and other chromosomal rearrangements of haematopoietic and lymphoid tissue neoplasms are reviewed.
METHODOLOGY: Cytokines and transcription factors in haematopoiesis and leukaemic mechanisms are described. Genetic features and clinical implications due to the encoded chimeric neoproteins causing malignant haematopoietic disorders are reviewed.
RESULTS AND DISCUSSION: Multiple translocation partner genes are well known for leukaemia such as MYC, MLL, RARA, ALK, and RUNX1. With the advent of more sophisticated diagnostic tools and bioinformatics algorithms, an exponential growth in fusion genes discoveries is likely to increase.
CONCLUSION: Demonstration of fusion genes and their specific translocation breakpoints in malignant haematological disorders are crucial for understanding the molecular pathogenesis and clinical phenotype of cancer, determining prognostic indexes and therapeutic responses, and monitoring residual disease and relapse status.

Matched MeSH terms: Hemoglobinopathies/genetics*
Fulltext Thalassaemia and haemoglobinopathies in Brunei Darussalam

Ismail JB

Med J Malaysia, 1992 Jun;47(2):98-102.
PMID: 1494340

One thousand consecutive Brunei Darussalam patients referred with low Hb, and/or low MCV and MCH (Hb < 12.5g/dl, MCV < 76fl, MCH < 27pg) were studied in the laboratory for underlying haemoglobinopathies. 30.0% of such patients were proved to have either beta-thalassaemia trait, beta-thalassaemia major, Hb AE, Hb EE, Hb E beta-thalassaemia or Hb H disease. In some, the haemoglobin abnormality was not identified precisely. Alpha-thalassaemia was suspected in an additional 4.3% of cases but confirmation study by globin-chain synthesis was not available. Beta-thalassaemia trait which was the predominant disorder was equally distributed among the three major race groups of Brunei Darussalam. Hb E was found exclusive among the Malay population. Hb H disease appeared as more common among the Chinese or the Malays (p > 0.05). This study reveals that thalassaemia and haemoglobinopathies are prevalent in Brunei Darussalam.

Matched MeSH terms: Hemoglobinopathies/genetics
Fulltext Secondary polycythaemia in a Malay girl with homozygous Hb Tak

Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S

Malays J Pathol, 2017 Dec;39(3):321-326.
PMID: 29279598 MyJurnal

Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.

Matched MeSH terms: Hemoglobinopathies/genetics*
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Hemoglobinopathies/genetics
Fulltext Haemoglobin Lepore in a Malay family: a case report

Pasangna J, George E, Nagaratnam M

Malays J Pathol, 2005 Jun;27(1):33-7.
PMID: 16676691

A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.

Matched MeSH terms: Hemoglobinopathies/genetics*
Hemoglobin Constant Spring (slow-moving hemoglobin X components) and hemoglobin e in Malayan aborigines

Eng LI, Baer A, Lewis AN, Welch QB

Am J Hum Genet, 1973 Jul;25(4):382-7.
PMID: 4716657
Matched MeSH terms: Hemoglobinopathies/genetics
Haemoglobin Bart's and slow-moving haemoglobin x components in newborns. The homozygous state for the slow-moving X components in a Malay boy

Lie-Injo LE

Acta Haematol., 1973;49(1):25-35.
PMID: 4632449 DOI: 10.1159/000208382

Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia

Matched MeSH terms: Hemoglobinopathies/genetics*
Homozygous state for Hb Constant Spring (slow-moving Hb X components)

Lie-Injo LE, Ganesan J, Clegg JB, Weatherall DJ

Blood, 1974 Feb;43(2):251-9.
PMID: 4810076
Matched MeSH terms: Hemoglobinopathies/genetics*
Inheritance of haemoglobin H disease. A new aspect

Lie-Injo LE, Lopez CG, Lopes M

Acta Haematol., 1971;46(2):106-20.
PMID: 4331171 DOI: 10.1159/000208565

A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies

Matched MeSH terms: Hemoglobinopathies/genetics*
High frequencies of a rearrangement (+ATA; -T) at -530 to the beta-globin gene in different populations indicate the absence of a correlation with a silent beta-thalassemia determinant

Wong SC, Stoming TA, Efremov GD, Huisman TH

Hemoglobin, 1989;13(1):1-5.
PMID: 2703362

DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).

Matched MeSH terms: Hemoglobinopathies/genetics
International perspectives on the implementation of reproductive carrier screening

Delatycki MB, Alkuraya F, Archibald A, Castellani C, Cornel M, Grody WW, et al.

Prenat Diagn, 2020 02;40(3):301-310.
PMID: 31774570 DOI: 10.1002/pd.5611

Reproductive carrier screening started in some countries in the 1970s for hemoglobinopathies and Tay-Sachs disease. Cystic fibrosis carrier screening became possible in the late 1980s and with technical advances, screening of an ever increasing number of genes has become possible. The goal of carrier screening is to inform people about their risk of having children with autosomal recessive and X-linked recessive disorders, to allow for informed decision making about reproductive options. The consequence may be a decrease in the birth prevalence of these conditions, which has occurred in several countries for some conditions. Different programs target different groups (high school, premarital, couples before conception, couples attending fertility clinics, and pregnant women) as does the governance structure (public health initiative and user pays). Ancestry-based offers of screening are being replaced by expanded carrier screening panels with multiple genes that is independent of ancestry. This review describes screening in Australia, Cyprus, Israel, Italy, Malaysia, the Netherlands, Saudi Arabia, the United Kingdom, and the United States. It provides an insight into the enormous variability in how reproductive carrier screening is offered across the globe. This largely relates to geographical variation in carrier frequencies of genetic conditions and local health care, financial, cultural, and religious factors.

Matched MeSH terms: Hemoglobinopathies/genetics
The distribution of blood genetic markers in immigrant Chinese populations

Hawkins BR

Acta Genet Med Gemellol (Roma), 1973;22:139-66.
PMID: 4790793
Matched MeSH terms: Hemoglobinopathies/genetics
Fulltext Rapid Targeted Next-Generation Sequencing Platform for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies

Shang X, Peng Z, Ye Y, Asan, Zhang X, Chen Y, et al.

EBioMedicine, 2017 Sep;23:150-159.
PMID: 28865746 DOI: 10.1016/j.ebiom.2017.08.015

Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies.

Matched MeSH terms: Hemoglobinopathies/genetics*