Displaying publications 1 - 20 of 32 in total

Abstract:
Sort:
  1. Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
    Matched MeSH terms: Hemoglobinopathies*
  2. Ismail JB
    Med J Malaysia, 1992 Jun;47(2):98-102.
    PMID: 1494340
    One thousand consecutive Brunei Darussalam patients referred with low Hb, and/or low MCV and MCH (Hb < 12.5g/dl, MCV < 76fl, MCH < 27pg) were studied in the laboratory for underlying haemoglobinopathies. 30.0% of such patients were proved to have either beta-thalassaemia trait, beta-thalassaemia major, Hb AE, Hb EE, Hb E beta-thalassaemia or Hb H disease. In some, the haemoglobin abnormality was not identified precisely. Alpha-thalassaemia was suspected in an additional 4.3% of cases but confirmation study by globin-chain synthesis was not available. Beta-thalassaemia trait which was the predominant disorder was equally distributed among the three major race groups of Brunei Darussalam. Hb E was found exclusive among the Malay population. Hb H disease appeared as more common among the Chinese or the Malays (p > 0.05). This study reveals that thalassaemia and haemoglobinopathies are prevalent in Brunei Darussalam.
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
  3. Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S
    Malays J Pathol, 2017 Dec;39(3):321-326.
    PMID: 29279598 MyJurnal
    Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
    Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*
  4. Boon WH
    Med J Malaya, 1968 Sep;23(1):61-6.
    PMID: 4237561
    Matched MeSH terms: Hemoglobinopathies/genetics*
  5. VELLA F
    Med J Malaya, 1958 Jun;12(4):602-4.
    PMID: 13577152
    Matched MeSH terms: Hemoglobinopathies*
  6. Kountouris P, Stephanou C, Archer N, Bonifazi F, Giannuzzi V, Kuo KHM, et al.
    Am J Hematol, 2021 Nov 01;96(11):E416-E420.
    PMID: 34406671 DOI: 10.1002/ajh.26323
    Matched MeSH terms: Hemoglobinopathies/genetics*
  7. Hirsch RE, Sibmooh N, Fucharoen S, Friedman JM
    Antioxid Redox Signal, 2017 05 10;26(14):794-813.
    PMID: 27650096 DOI: 10.1089/ars.2016.6806
    SIGNIFICANCE: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected.

    CRITICAL ISSUES: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events.

    FUTURE DIRECTIONS: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

    Matched MeSH terms: Hemoglobinopathies/drug therapy*; Hemoglobinopathies/metabolism; Hemoglobinopathies/physiopathology*
  8. Saleem M, Yusoff NM
    Hematology, 2016 Oct;21(9):501-12.
    PMID: 26871368 DOI: 10.1080/10245332.2015.1106816
    OBJECTIVES: The new World Health Organization's (WHO) classification of haematopoietic and lymphoid tissue neoplasms incorporating the recurrent fusion genes as the defining criteria for different haematopoietic malignant phenotypes is reviewed. The recurrent fusion genes incorporated in the new WHO's classification and other chromosomal rearrangements of haematopoietic and lymphoid tissue neoplasms are reviewed.

    METHODOLOGY: Cytokines and transcription factors in haematopoiesis and leukaemic mechanisms are described. Genetic features and clinical implications due to the encoded chimeric neoproteins causing malignant haematopoietic disorders are reviewed.

    RESULTS AND DISCUSSION: Multiple translocation partner genes are well known for leukaemia such as MYC, MLL, RARA, ALK, and RUNX1. With the advent of more sophisticated diagnostic tools and bioinformatics algorithms, an exponential growth in fusion genes discoveries is likely to increase.

    CONCLUSION: Demonstration of fusion genes and their specific translocation breakpoints in malignant haematological disorders are crucial for understanding the molecular pathogenesis and clinical phenotype of cancer, determining prognostic indexes and therapeutic responses, and monitoring residual disease and relapse status.

    Matched MeSH terms: Hemoglobinopathies/genetics*
  9. George E, Sivagengei K
    Med J Malaysia, 1982 Jun;37(2):102-3.
    PMID: 7132828
    Matched MeSH terms: Hemoglobinopathies/blood*
  10. Lambeth JT, Burns-Cox CJ, MacLean R
    Radiology, 1970 May;95(2):413-5.
    PMID: 5439452 DOI: 10.1148/95.2.413
    Two patients with gout associated with the presence of an abnormal hemoglobin, Hb E, and hypersplenism are presented. Very large sclerotic-rimmed cystic erosions in the sacroiliac joints of both patients are unusual but characteristic of the skeletal lesions of gout. The hyperuricemia may be the result of the disordered nucleic acid metabolism associated with hemoglobin abnormality. The development of hypersplenism very likely accelerated this process and resulted in the clinical and radiographic manifestations of severe gout.
    INDEX TERMS: Blood, diseases • Blood, proteins • globin and Hemoglobin Compounds • Sacroiliac Joint trophy
    Study site: Hospital Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/complications*
  11. Riahi S, Mei IL, Idris FB, George E, Noor SM
    PMID: 26863862
    Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/etiology; Hemoglobinopathies/epidemiology*
  12. Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/genetics*
  13. Eng LI, Baer A, Lewis AN, Welch QB
    Am J Hum Genet, 1973 Jul;25(4):382-7.
    PMID: 4716657
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
  14. Baig MA, Swamy KB, Baksh AD, Bahashwan A, Moshrif Y, Al Sawat A, et al.
    Indian J Pathol Microbiol, 2021 8 4;64(3):518-523.
    PMID: 34341263 DOI: 10.4103/IJPM.IJPM_709_20
    Background: : HPLC is one of the most important tools for accurate diagnosis of hemoglobinopathies and thalassemias. The advantage of the HPLC system is the excellent resolution, reproducibility &quantification of several normal and abnormal hemoglobin.

    Results: BIO RAD Variant II analyzer was used. Sickle cell syndromes including double heterozygous states accounted for 56.13% of total cases. HbSS, HbS/β0-th, HbS/β+-th β-thal trait comprises 29%, 6.5%, 5.1%& 10% of total cases respectively with mean MCV (fl) = 84, 68,71,64 respectively. The Mean HbA2 for β-thal trait, HbE trait &HbE-β thal showed 5.1 ± 1.1, 19 ± 9 & 24 ± 8 respectively. HbF is increased in 8.6% case (excluding SC syndromes & β-thal disorders), of these 5.5% were infants & 12 cases of Aplastic Anemias. Peak P2 >7% (2.4% cases) was seen in uncontrolled diabetes mellitus which on quantification showed HbA1C = 8 ± 2.1 mmol/L.

    Discussion: : HPLC in correlation with CBC parameters & family studies can aid in the diagnosis of majority of Hemoglobinopathies and thalassemic syndrome. The CBC & HPLC parameters of the present study are in good correlation with the research conducted by Tejinder Sing, RiouJ & Alla Joutovsky. Present study showed HPLC comprehensively characterizing HbS, A, A2, F, S, C, D from each other & was also applicable for the quantification of HbA1c for the monitoring of Diabetes Mellitus.

    Conclusion: : The merits of HPLC are small quantity of sample required, economical, less TAT, accurate categorization of HbS, HbA2 & F. But one has to be aware of the limitations and problems associated with this method due to variant hemoglobin within the same retention windows. The present findings show HPLC as an excellent & powerful diagnostic tool for the direct identification of hemoglobin variants with a high degree of precision in the quantification of normal and abnormal hemoglobin fractions.

    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/diagnosis*
  15. Lie-Injo LE, Lopez CG, Lopes M
    Acta Haematol., 1971;46(2):106-20.
    PMID: 4331171 DOI: 10.1159/000208565
    A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
    Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies
    Matched MeSH terms: Hemoglobinopathies/complications; Hemoglobinopathies/genetics*
  16. Shang X, Peng Z, Ye Y, Asan, Zhang X, Chen Y, et al.
    EBioMedicine, 2017 Sep;23:150-159.
    PMID: 28865746 DOI: 10.1016/j.ebiom.2017.08.015
    Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies.
    Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*; Hemoglobinopathies/epidemiology
  17. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobinopathies/genetics
  18. Lie-Injo LE
    Acta Haematol., 1973;49(1):25-35.
    PMID: 4632449 DOI: 10.1159/000208382
    Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
    Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia
    Matched MeSH terms: Hemoglobinopathies/genetics*
  19. Ong HC
    Acta Haematol., 1974;52(4):220-2.
    PMID: 4217527 DOI: 10.1159/000208244
    Haemoglobin E complicates 22.2°/o of pregnancy in Malaysian aborigines, the prevalence of variants associated with pregnancy being, 15.8% with Hb E trait abnormality, 3.9% with Hb E homozygous disease, and 2.5% with Hb E thalassaemia disease. Minor haematological abnormalities occur with the trait and homozygous conditions, though a more unfavourable response is expected with Hb E thalassaemia. Haemolysis is not a prominent feature and it is suggested that factors other than the haemoglobinopathic state
    probably accounts for any unfavourable response in pregnancy.
    Key Words: Haemoglobin E; Haemoglobinopathies; Haemolytic anaemias; Hb E thalassaemia; Malaysia; Pregnancy
    Study site: Hospital Orang Asli, Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/blood
  20. Wan Mohd Saman WA, Hassan R, Mohd Yusoff S, Che Yaakob CA, Abdullah NA, Ghazali S, et al.
    Malays J Pathol, 2016 Dec;38(3):235-239.
    PMID: 28028293 MyJurnal
    BACKGROUND: Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).

    METHODS: Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).

    RESULTS: Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.

    CONCLUSION: Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

    Matched MeSH terms: Hemoglobinopathies/diagnosis*
Filters
Contact Us

Please provide feedback to Administrator ([email protected])

External Links