MyMedR

Displaying all 11 publications

Abstract:

Sort:

Transfusion practice blind spot in para-Bombay: A case report

Abdullah MR, Faizli AA, Noordin SS, Lee CJ, Ahmad NH

Transfus Apher Sci, 2021 Jun;60(3):103076.
PMID: 33574008 DOI: 10.1016/j.transci.2021.103076

H-deficient phenotype individuals with absent or weak anti-H activity may remain undetected on standard routine blood grouping. We report a case of a 59-year-old-man presented with symptomatic anaemia secondary to upper gastrointestinal bleed with haemoglobin level of 68 g/L who required two units of packed red blood cells. He was previously grouped as O Rh D positive and had a history of uneventful multiple blood transfusions. His latest pre-transfusion investigations showed ABO discrepancy between forward and reverse blood grouping, pan-agglutination in both antibody screening and identification with negative direct Coombs test and autocontrol. Further testing including anti-H lectin test and saliva secretor study confirmed that the patient blood group was para-Bombay B RhD positive. This case highlights that the para-Bombay phenotype can be mistakenly labelled as "O" if further investigations are not performed.

Matched MeSH terms: Blood Transfusion/methods*
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Blood Transfusion/methods*
Domestic and imported products--the Malaysian experience in assuring safe and sufficient plasma products

Ayob Y

Dev Biol (Basel), 2007;127:169-73.
PMID: 17486890
Matched MeSH terms: Blood Transfusion/methods*
Preventive transfusion in Dengue shock syndrome-is it necessary?

Lum LC, Abdel-Latif Mel-A, Goh AY, Chan PW, Lam SK

J Pediatr, 2003 Nov;143(5):682-4.
PMID: 14615749

We compared 53 patients with Dengue shock syndrome (DSS) who received preventive transfusions with 53 who did not. Significant differences in the development of pulmonary edema and length of hospitalization (P

Matched MeSH terms: Blood Transfusion/methods*
Importance of extended blood group genotyping in multiply transfused patients

Osman NH, Sathar J, Leong CF, Zulkifli NF, Raja Sabudin RZA, Othman A, et al.

Transfus Apher Sci, 2017 Jun;56(3):410-416.
PMID: 28438419 DOI: 10.1016/j.transci.2017.03.009

Blood group antigen systems are not limited to the ABO blood groups. There is increasing interest in the detection of extended blood group systems on the red cell surface. The conventional method used to determine extended blood group antigens or red cell phenotype is by serological testing, which is based on the detection of visible haemagglutination or the presence of haemolysis. However, this technique has many limitations due to recent exposure to donor red cell, certain drugs or medications or other diseases that may alter the red cell membrane. We aimed to determine the red cell blood group genotype by SNP real time PCR and to compare the results with the conventional serological methods in multiply transfused patients. Sixty-three patients participated in this study whose peripheral blood was collected and blood group phenotype was determined by serological tube method while the genotype was performed using TaqMan®Single Nucleotide Polymorphism (SNP) RT-PCR assays for RHEe, RHCc, Kidd and Duffy blood group systems. Discrepancies were found between the phenotype and genotype results for all blood groups tested. Accurate red blood cell antigen profiling is important for patients requiring multiple transfusions. The SNP RT-PCR platform is a reliable alternative to the conventional method.

Matched MeSH terms: Blood Transfusion/methods*
Fulltext Potassium and massive blood transfusion

Reddy SV, Sein K

Singapore Med J, 1991 Feb;32(1):29-30.
PMID: 2017701

Sixty patients who received massive blood transfusion intraoperatively and/or in the immediate post-operative period were analysed. Six patients had hypokalemia and two had hyperkalemia. The multifactorial changes leading to electrolyte disturbances especially involving potassium are discussed in relation to hypotension, hypothermia, acidosis, pH, and release of catecholamine. Potassium changes in relation to anaesthesia are discussed. The danger of routine administration of calcium during massive blood transfusion is stressed.

Matched MeSH terms: Blood Transfusion/methods*
Evaluation of serological transfusion-transmitted viral diseases and mutliplex nucleic acid testing in malaysian blood donors

Yaseen SG, Ahmed SA, Johan MF, Kiron R, Daher AM

Transfus Apher Sci, 2013 Dec;49(3):647-51.
PMID: 23890575 DOI: 10.1016/j.transci.2013.07.003

Transmission of infectious diseases is a recognized complication of blood transfusion and blood products. Nucleic acid testing (NAT) may contribute to improved efficiency of blood screening and thereby increase the safety margin for transfused blood.

Matched MeSH terms: Blood Transfusion/methods*
Effect of intraoperative autologous transfusion techniques on perioperative hemoglobin level in idiopathic scoliosis patients undergoing posterior spinal fusion: A prospective randomized trial

Hasan MS, Choe NC, Chan CYW, Chiu CK, Kwan MK

J Orthop Surg (Hong Kong), 2017 May-Aug;25(2):2309499017718951.
PMID: 28675975 DOI: 10.1177/2309499017718951

BACKGROUND: Massive blood loss during posterior spinal fusion for adolescent idiopathic scoliosis remains a significant risk for patients. There is no consensus on the benefit of acute normovolemic hemodilution (ANH) or intraoperative cell salvage (ICS) in scoliosis surgery.

METHODS: Patients were randomized to one of two groups. Group A received ANH and ICS during operation, while group B received only ICS. Patients' age, sex, height, weight, body blood volume, number of fusion level, Cobb angle, number of screws, duration of surgery, and skin incision length were recorded. Hemoglobin and hematocrit levels were obtained preoperatively and postoperatively (0 h and 24 h).

RESULTS: There were 22 patients in each group. There was no significant difference in total blood loss. The perioperative decrease in hemoglobin levels between preoperation and postoperation 24 h (group A 2.79 ± 1.15 and group B 2.76 ± 1.00) showed no significant difference ( p = 0.93). Group A observed a larger decrease in hemoglobin levels at postoperative 0 h relative to preoperative level (2.57 ± 0.82 g/dl), followed by a smaller decrease within the next 24 h (0.22 ± 1.33 g/dl). Group B showed a continued drop in hemoglobin levels of similar magnitude at postoperation 0 h (1.60 ± 0.67 g/dl) and within the next 24 h (1.16 ± 0.78 g/dl). One patient from group B received 1 unit of allogenic blood transfusion ( p = 0.33).

CONCLUSIONS: The addition of ANH to ICS in posterior spinal fusion surgery for AIS resulted in a similar decrease in hemoglobin levels between preoperative values and at 24 h postoperatively.

Matched MeSH terms: Blood Transfusion/methods*
Perioperative Outcome of Severe Idiopathic Scoliosis (Cobb Angle ≥ 90°): Is There Any Difference Between "Daytime" Versus "After-hours" Surgeries?

Mihara Y, Chung WH, Chiu CK, Hasan MS, Lee SY, Ch'ng PY, et al.

Spine (Phila Pa 1976), 2020 Mar 15;45(6):381-389.
PMID: 31574058 DOI: 10.1097/BRS.0000000000003274

STUDY DESIGN: Retrospective study from a prospectively collected database.
OBJECTIVE: To compare the perioperative outcome between after-hours and daytime surgery carried out by a dedicated spinal deformity team for severe Idiopathic Scoliosis (IS) patients with Cobb angle ≥ 90°.
SUMMARY OF BACKGROUND DATA: There were concerns that after-hours corrective surgeries in severe IS have higher morbidity compared to daytime surgeries.
METHODS: Seventy-one severe IS patients who underwent single-staged Posterior Spinal Fusion (PSF) were included. Surgeries performed between 08:00H and 16:59H were classified as "daytime" group and surgeries performed between 17:00H and 06:00H were classified as "after-hours" group. Perioperative outcome parameters were average operation start time and end time, operation duration, intraoperative blood loss, intraoperative hemodynamic parameters, preoperative and postoperative hemoglobin, blood transfusion rate, total patient-controlled anesthesia (PCA) morphine usage, length of postoperative hospitalization, and complications. Radiological variables assessed were preoperative and postoperative Cobb angle, side bending flexibility, number of fusion levels, number of screws used, Correction Rate, and Side Bending Correction Index.
RESULTS: Thirty patients were operated during daytime and 41 patients were operated after-hours. The mean age was 16.1 ± 5.8 years old. The mean operation start time for daytime group was 11:31 ± 2:45H versus 19:10 ± 1:24H for after-hours group. There were no significant differences between both groups in the operation duration, intraoperative blood loss, intraoperative hemodynamic parameters, postoperative hemoglobin, hemoglobin drift, transfusion rate, length of postoperative hospitalization, postoperative Cobb angle, Correction Rate, and Side Bending Correction Index. There were four complications (1 SSEP loss, 1 massive blood loss, and 2 superficial wound infections) with no difference between daytime and after-hours group.
CONCLUSION: After-hours elective spine deformity corrective surgeries in healthy ambulatory patients with severe IS performed by a dedicated spinal deformity team using dual attending surgeon strategy were as safe as those performed during daytime.
LEVEL OF EVIDENCE: 4.

Matched MeSH terms: Blood Transfusion/methods
Fulltext A prospective study on the use of leucocyte-filters in reducing blood transfusion reactions in multi-transfused thalassemic children

Tan KK, Lee WS, Liaw LC, Oh A

Singapore Med J, 1993 Apr;34(2):109-11.
PMID: 8266145

Two hundred and eleven blood transfusions were administered to 26 multi-transfused thalassemic children (aged 9 months-13 years) over a 6-month period. Eighteen children were receiving buffy coat-poor packed red cells (PRC) prepared by centrifuge while 8 children received filtered blood through a leucocyte-filter (Sepacell R-500A). Transfusion reactions occurred in 8.5% (n = 18) of transfusions and in 42.3% (n = 11) of patients. 11.9% (n = 16) and 2.6% (n = 2) of reactions occurred in 50% (n = 9) and 25% (n = 2) of patients receiving buffy coat-poor PRC and filtered blood respectively. Transfusion reactions in toto were significantly reduced in the group receiving filtered blood (p < 0.05). However, febrile reaction alone was not significantly reduced (p > 0.1). The median onset and duration of reaction were 2 hours (range 10 minutes-18 hours) and 4 hours (range 1/2-24 hours) respectively. 72.2% (n = 13) of the reactions occurred occurred during transfusion. 88.8% (n = 16) of the reactions caused only one symptom. 19.2% (n = 5) of all patients had recurrent reactions, all of them receiving buffy coat-poor PRC. The commonest clinical manifestation was fever (n = 7), followed by urticaria (n = 5) and petechial rash (n = 2). The outcome was good, with no patient experiencing symptoms exceeding 24 hours. Only 0.9% (n = 2) of the transfusions were discontinued.

Matched MeSH terms: Blood Transfusion/methods
Hemovigilance in developing countries

Ayob Y

Biologicals, 2010 Jan;38(1):91-6.
PMID: 20133151 DOI: 10.1016/j.biologicals.2009.10.002

Hemovigilance like quality systems and audits has become an integral part of the Blood Transfusion Service (BTS) in the developed world and has contributed greatly to the development of the blood service. However developing countries are still grappling with donor recruitment and efforts towards sufficiency and safety of the blood supply. In these countries the BTS is generally fragmented and a national hemovigilance program would be difficult to implement. However a few developing countries have an effective and sustainable blood program that can deliver equitable, safe and sufficient blood supply to the nation. Different models of hemovigilance program have been introduced with variable success. There are deficiencies but the data collected provided important information that can be presented to the health authorities for effective interventions. Hemovigilance program modeled from developed countries require expertise and resources that are not available in many developing countries. Whatever resources that are available should be utilized to correct deficiencies that are already apparent and obvious. Besides there are other tools that can be used to monitor the blood program in the developing countries depending on the need and the resources available. More importantly the data collected should be accurate and are used and taken into consideration in formulating guidelines, standards and policies and to affect appropriate interventions. Any surveillance program should be introduced in a stepwise manner as the blood transfusion service develops.

Matched MeSH terms: Blood Transfusion/methods