Displaying publications 1 - 20 of 355 in total

Abstract:
Sort:
  1. Fulltext The Application of Chemometrics in Metabolomic and Lipidomic Analysis Data Presentation for Halal Authentication of Meat Products
    Maritha V, Harlina PW, Musfiroh I, Gazzali AM, Muchtaridi M
    Molecules, 2022 Nov 04;27(21).
    PMID: 36364396 DOI: 10.3390/molecules27217571
    The halal status of meat products is an important factor being considered by many parties, especially Muslims. Analytical methods that have good specificity for the authentication of halal meat products are important as quality assurance to consumers. Metabolomic and lipidomic are two useful strategies in distinguishing halal and non-halal meat. Metabolomic and lipidomic analysis produce a large amount of data, thus chemometrics are needed to interpret and simplify the analytical data to ease understanding. This review explored the published literature indexed in PubMed, Scopus, and Google Scholar on the application of chemometrics as a tool in handling the large amount of data generated from metabolomic and lipidomic studies specifically in the halal authentication of meat products. The type of chemometric methods used is described and the efficiency of time in distinguishing the halal and non-halal meat products using chemometrics methods such as PCA, HCA, PLS-DA, and OPLS-DA is discussed.
    Matched MeSH terms: Meat/analysis
  2. Lacto-fermented garlic sauce improved the quality and extended the shelf life of lamb meat under the chilled condition
    Hajar-Azhari S, Daud N, Muhialdin BJ, Joghee N, Kadum H, Meor Hussin AS
    Int J Food Microbiol, 2023 Jun 16;395:110190.
    PMID: 37030193 DOI: 10.1016/j.ijfoodmicro.2023.110190
    This study evaluated the potential of fermented garlic as a marinated lamb sauce ingredient to improve the quality and shelf life of chilled lamb. Garlic was subjected to Lacto-fermentation for 72 h at 37 °C using Lacticaseibacillus casei. The 1H NMR metabolomics profile showed the presence of eight amino acids and five organic acids in fermented garlic, indicating the attribution to the antioxidant and antimicrobial activities. The FRAP and DPPH assays of fermented garlic revealed antioxidant activities of 0.45 ± 0.09 mmol/100 g DW and 93.85 ± 0.02 %, respectively. Meanwhile, fermented garlic inhibited the growth of Escherichia coli (95 %), Staphylococcus aureus (99 %) and Salmonella Typhimurium (98 %). When fermented garlic was added to the marinade sauce, it successfully reduced the microbial load of lamb meat by 0.5 log CFU/g after 3 days of storage. There were no significant differences in color between the control and marinated lamb after 3 days of marinating in a sauce formulated with fermented garlic. Furthermore, marinated lamb significantly improved water-holding capacity, texture, juiciness, and overall acceptance. These findings indicated a potential addition of fermented garlic in marinade lamb sauce recipes to improve the quality and safety of meat products.
    Matched MeSH terms: Red Meat*; Meat/analysis
  3. Quality characteristics of Malaysian commercial beef frankfurters
    Nurul, H., Alistair, T.L.J., Lim, H.W., Noryati, I.
    International Food Research Journal, 2010;17(2):469-476.
    MyJurnal
    Five different brands of Malaysian commercial beef frankfurters were analyzed for quality characteristics. The proximate contents showed significant differences among the samples. The range of moisture content was 63.0-73.9%; the protein content was 10.63-16.43% while the fat content was 1.71-12.22%. The lightness value (L*) of the uncooked frankfurters, which was in the range of 47.02-52.28, was significantly different among the samples. The lightness of the cooked frankfurters, showed a decrease in all the samples compared to the uncooked samples. No significant differences were observed for the folding test; where all samples showed no cracks after they were folded in half. However, significant differences were observed for the texture analysis. The hardness, cohesiveness, chewiness, springiness, gumminess and shear force ranged between 4.59-10.30 kg, 0.26-0.35, 16.15-51.72 kgmm, 12.73-14.79 mm, 1.17-3.49 kg and 1.67-7.08 kg respectively. The results of the study showed that Malaysian commercial beef frankfurters were significantly different in their physicochemical properties.
    Matched MeSH terms: Red Meat; Meat; Meat Products
  4. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication
    Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Red Meat/analysis; Meat/analysis; Meat Products/analysis
  5. A novel infrared and microwave alternate thawing method for frozen pork: Effect on thawing rate and products quality
    Hu R, Zhang M, Jiang Q, Law CL
    Meat Sci, 2023 Apr;198:109084.
    PMID: 36599205 DOI: 10.1016/j.meatsci.2022.109084
    The effect of infrared and microwave alternate thawing (IR + MWT) on frozen pork were compared to fresh, air thawing (AT), infrared thawing (IRT), microwave thawing (MWT). The IR + MWT took only about 11.81 min of the thawing time compared to AT 66.5 min, and the Raman spectroscopy and Low-field nuclear magnetic resonance (LF-NMR) results showed that the IR + MWT maintained better protein secondary structure composition and moisture state compared to MWT and IRT. In terms of thawing losses, IR + MWT had the lowest loss 1.92%. In terms of texture, IR + MWT had the least effect on the post-thawing textural properties and increased the springiness of the meat. Scanning electron microscopy results also showed that there was reduced damage to the muscle structure with IR + MWT. Regarding the odor of the meat after thawing, IR + MWT retained the odor better and was closer to the fresh sample. Therefore, IR + MWT can be used to enhance the thawing rate to protect the quality of the thawed pork.
    Matched MeSH terms: Red Meat*; Meat/analysis
  6. Fulltext Analysis of Pork in Beef Sausages Using LC-Orbitrap HRMS Untargeted Metabolomics Combined with Chemometrics for Halal Authentication Study
    Windarsih A, Bakar NKA, Dachriyanus, Yuliana ND, Riswanto FDO, Rohman A
    Molecules, 2023 Aug 09;28(16).
    PMID: 37630216 DOI: 10.3390/molecules28165964
    Beef sausage (BS) is one of the most favored meat products due to its nutrition and good taste. However, for economic purposes, BS is often adulterated with pork by unethical players. Pork consumption is strictly prohibited for religions including Islam and Judaism. Therefore, advanced detection methods are highly required to warrant the halal authenticity of BS. This research aimed to develop a liquid chromatography-high-resolution mass spectrometry (LC-HRMS) method to determine the halal authenticity of BS using an untargeted metabolomics approach. LC-HRMS was capable of detecting various metabolites in BS and BS containing pork. The presence of pork in BS could be differentiated using principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) with high accuracy. PLS-DA perfectly classified authentic BS and BS containing pork in all concentration levels of pork with R2X = (0.821), R2Y(= 0.984), and Q2 = (0.795). The level of pork in BS was successfully predicted through partial least squares (PLS) and orthogonal PLS (OPLS) chemometrics. Both models gave high R2 (>0.99) actual and predicted values as well as few errors, indicating good accuracy and precision. Identification of discriminating metabolites' potential as biomarker candidates through variable importance for projections (VIP) value revealed metabolites of 2-arachidonyl-sn-glycero-3-phosphoethanolamine, 3-hydroxyoctanoylcarnitine, 8Z,11Z,14Z-eicosatrienoic acid, D-(+)-galactose, oleamide, 3-hydroxyhexadecanoylcarnitine, arachidonic acid, and α-eleostearic acid as good indicators to detect pork. It can be concluded that LC-HRMS metabolomics combined with PCA, PLS-DA, PLS, and OPLS was successfully used to detect pork adulteration in beef sausages. The results imply that LC-HRMS untargeted metabolomics in combination with chemometrics is a promising alternative as an analytical technique to detect pork in sausage products. Further analysis of larger samples is required to warrant the reproducibility.
    Matched MeSH terms: Red Meat*; Meat Products*
  7. Fulltext Halal Food Performance and Its Influence on Patron Retention Process at Tourism Destination
    Han H, Lho LH, Raposo A, Radic A, Ngah AH
    Int J Environ Res Public Health, 2021 03 16;18(6).
    PMID: 33809470 DOI: 10.3390/ijerph18063034
    Muslim tourism is one of the most rapidly developing sectors in the international tourism industry. Nevertheless, halal food performance and its relationship with international Muslim traveler decision-making and behaviors have not been sufficiently examined. The present research explored the influence of halal food performance, which encompasses availability, health/nutrition, accreditation, and cleanness/safety/hygiene factors, on the Muslim traveler retention process at a non-Islamic destination. A survey methodology with a quantitative data analytic approach was employed to achieve research goals. Our findings indicated that halal food performance increased destination trust and destination attachment, which in turn influenced Muslim traveler retention. Additionally, the efficacy of the higher-order framework of halal food performance was defined. Both destination trust and attachment mediated the effect of halal food performance on retention. A halal-friendly destination image included a moderating influence on the retention process. The effectiveness of the proposed theoretical framework for explicating Muslim traveler behaviors was uncovered. This research better introduces the importance of halal food performance and its attributes for the elicitation of Muslim traveler approach responses and behaviors at a non-Islamic destination to researchers and practitioners.
    Matched MeSH terms: Meat/analysis
  8. Halal authentication using lateral flow devices for detection of pork adulteration in meat products: a review
    Raja Nhari RMH, Soh JH, Khairil Mokhtar NF, Mohammad NA, Mohd Hashim A
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2023 Aug;40(8):971-980.
    PMID: 37535014 DOI: 10.1080/19440049.2023.2242955
    Lateral flow devices (LFDs) are straightforward scientific tools that have made substantial advances in recent years. They have been used in many fields including the meat industry to detect disease markers, determine meat freshness or meat species determination. They are, therefore, significant in the research of meat adulteration by mixed animal species, because food component authenticity is a serious concern encompassing health, economic, legal, and religious issues. Pork adulteration is one of the most crucial issues in the global meat industry. In this review, we discuss the various types of LFDs and recent research on the development of LFDs as an authenticity tool for detecting pig additives in meat-based products, and how regulatory authorities could adopt LFDs for their workflows. Despite the benefits of rapidity, simplicity, low cost, high sensitivity, and specificity, researchers face challenges when using LFD as a final confirmation test. Future directions are suggested for globalising the use of LFD as a halal authentication method.
    Matched MeSH terms: Meat/analysis
  9. New insights in improving sustainability in meat production: opportunities and challenges
    Kumar P, Abubakar AA, Verma AK, Umaraw P, Adewale Ahmed M, Mehta N, et al.
    Crit Rev Food Sci Nutr, 2023 Nov;63(33):11830-11858.
    PMID: 35821661 DOI: 10.1080/10408398.2022.2096562
    Treating livestock as senseless production machines has led to rampant depletion of natural resources, enhanced greenhouse gas emissions, gross animal welfare violations, and other ethical issues. It has essentially instigated constant scrutiny of conventional meat production by various experts and scientists. Sustainably in the meat sector is a big challenge which requires a multifaced and holistic approach. Novel tools like digitalization of the farming system and livestock market, precision livestock farming, application of remote sensing and artificial intelligence to manage production and environmental impact/GHG emission, can help in attaining sustainability in this sector. Further, improving nutrient use efficiency and recycling in feed and animal production through integration with agroecology and industrial ecology, improving individual animal and herd health by ensuring proper biosecurity measures and selective breeding, and welfare by mitigating animal stress during production are also key elements in achieving sustainability in meat production. In addition, sustainability bears a direct relationship with various social dimensions of meat production efficiency such as non-market attributes, balance between demand and consumption, market and policy failures. The present review critically examines the various aspects that significantly impact the efficiency and sustainability of meat production.
    Matched MeSH terms: Meat/analysis
  10. Halal authenticity issues in meat and meat products
    Nakyinsige K, Man YB, Sazili AQ
    Meat Sci, 2012 Jul;91(3):207-14.
    PMID: 22405913 DOI: 10.1016/j.meatsci.2012.02.015
    In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products.
    Matched MeSH terms: Meat/analysis*; Meat Products/analysis*
  11. Optimizing palm oil and palm stearin utilization for sensory and textural properties of chicken frankfurters
    Tan SS, Aminah A, Zhang XG, Abdul SB
    Meat Sci, 2006 Mar;72(3):387-97.
    PMID: 22061722 DOI: 10.1016/j.meatsci.2005.07.012
    This study was designed to explore the potential of refined, bleached and deodorized (RBD) palm oil (PO) and palm stearin (POs) utilization in chicken frankfurters. A 10 points augmented simplex-centroid design was used to study the effect of chicken fat (CF), PO and POs as well as the interaction of these fats on the emulsion, textural and sensory properties of chicken frankfurters. All frankfurters were formulated to contain approx 25% fat, 52% moisture and 10% protein. No significant difference was found in end chopping temperatures of all meat batters even though the temperature of PO and POs upon incorporation into meat batters was 50°C higher than CF. Strong emulsions were formed as no fluid losses were observed in all the meat batters tested after heating. Texture profiles of the frankfurters containing PO and/or CF were quite similar, but increment of POs raised hardness, chewiness, and shear hardness of the frankfurters. Acceptability of the frankfurters was evaluated using hedonic test. Panelists found no difference in hardness preference between frankfurters made from totally CF and PO, while frankfurters made from POs were rated as hard and brittle. CF was important in determining acceptability of the frankfurters, as reduction of CF in formulation resulted in lower scores in chicken flavor, juiciness, oiliness and overall acceptance of the frankfurters. Frankfurters with sensory acceptability comparable to a commercial one were found to comprise of more than 17% CF, and less than 67% PO and 17% POs of the fat blend.
    Matched MeSH terms: Meat; Meat Products
  12. pH as analytical indicator for managing pork meat quality
    Kim TW, Kim CW, Kwon SG, Hwang JH, Park DH, Kang DG, et al.
    Sains Malaysiana, 2016;45:1097-1103.
    In order to examine differences of meat quality traits depending on pH values post-mortem, the pH range was classified
    according to initial pH (pH45min) and ultimate pH (pH24hr) post-mortem. The differences of meat quality traits depending
    on sex were not changed by a number of amount, except for backfat thickness and fat content. The value of pH45min was
    positively correlated with pHdif, whereas pH24hr was negatively associated with lightness (CIE L*) and protein content. At
    pH45min post-slaughter, collagen content, fat content, shear force, water holding capacity and yellowness (CIE b*) showed
    lower values at the higher pH range of pH>6.7 than those of other ranges, but CIE L* and redness (CIE a*) presented
    the lowest value at the intermediate pH range of pH6.3~6.7. Conversely, at pH24hr post-slaughter, fat and moisture
    contents maintained the highest average values at the higher pH range of pH>6.1, but protein content showed higher
    value at the lower pH range of pH<5.7. Higher pH24hr appeared significantly lower shear force, but higher water holding
    capacity. CIE L*, a*, and b* values showed significantly higher values at the lowest region of pH24hr. Since meat quality
    characteristics seemed to be favored by consumers in rather than at the range of pH5.7~6.1, which showed significant
    differences of meat color, appearance, and meat juiciness, it is suggested that production of pork meat to appropriate
    pH value is performed by pig breeders and control measures taken during pre- and post-slaughters.
    Matched MeSH terms: Red Meat; Meat
  13. Fulltext Detection of Pork in Beef Meatballs Using LC-HRMS Based Untargeted Metabolomics and Chemometrics for Halal Authentication
    Windarsih A, Riswanto FDO, Bakar NKA, Yuliana ND, Dachriyanus, Rohman A
    Molecules, 2022 Nov 29;27(23).
    PMID: 36500423 DOI: 10.3390/molecules27238325
    Adulteration of high-quality meat products using lower-priced meats, such as pork, is a crucial issue that could harm consumers. The consumption of pork is strictly forbidden in certain religions, such as Islam and Judaism. Therefore, the objective of this research was to develop untargeted metabolomics using liquid chromatography-high resolution mass spectrometry (LC-HRMS) combined with chemometrics for analysis of pork in beef meatballs for halal authentication. We investigated the use of non-targeted LC-HRMS as a method to detect such food adulteration. As a proof of concept using six technical replicates of pooled samples from beef and pork meat, we could show that metabolomics using LC-HRMS could be used for high-throughput screening of metabolites in meatballs made from beef and pork. Chemometrics of principal component analysis (PCA) was successfully used to differentiate beef meatballs and pork meatball samples. Partial least square-discriminant analysis (PLS-DA) clearly discriminated between halal and non-halal beef meatball samples with 100% accuracy. Orthogonal projection to latent structures-discriminant analysis (OPLS-DA) perfectly discriminated and classified meatballs made from beef, pork, and a mixture of beef-pork with a good level of fitness (R2X = 0.88, R2Y = 0.71) and good predictivity (Q2 = 0.55). Partial least square (PLS) and orthogonal PLS (OPLS) were successfully applied to predict the concentration of pork present in beef meatballs with high accuracy (R2 = 0.99) and high precision. Thirty-five potential metabolite markers were identified through VIP (variable important for projections) analysis. Metabolites of 1-(1Z-hexadecenyl)-sn-glycero-3-phosphocholine, acetyl-l-carnitine, dl-carnitine, anserine, hypoxanthine, linoleic acid, and prolylleucine had important roles for predicting pork in beef meatballs through S-line plot analysis. It can be concluded that a combination of untargeted metabolomics using LC-HRMS and chemometrics is promising to be developed as a standard analytical method for halal authentication of highly processed meat products.
    Matched MeSH terms: Meat/analysis
  14. Are plant-based alternatives healthier? A two-dimensional evaluation from nutritional and processing standpoints
    de Las Heras-Delgado S, Shyam S, Cunillera È, Dragusan N, Salas-Salvadó J, Babio N
    Food Res Int, 2023 Jul;169:112857.
    PMID: 37254431 DOI: 10.1016/j.foodres.2023.112857
    BACKGROUND: Plant-Based Alternative Products (PBAPs) to meat and dairy are increasingly available. Their relative nutritional quality in comparison to animal-based homologs is poorly documented.

    OBJECTIVE: To characterize and evaluate the plant-based alternatives available on the market in Spain in comparison to animal products in terms of their nutritional composition and profile, and degree of processing.

    METHODS: Nutritional information for PBAPs and homologs were obtained from the Spanish 'Veggie base', branded food composition database. Five PBAPs categories (cheese, dairy products, eggs, meat, and fish, n = 922) were compared to animal-based processed (n = 922) and unprocessed (n = 381) homologs, using the modified version of the Food Standard Agency Nutrient Profiling System (FSAm-NPS score) and NOVA classification criteria.

    RESULTS: Compared to processed or unprocessed animal food, PBAPs contain significantly higher sugar, salt, and fiber. PBAPs for fish, seafood, and meat were lower in protein and saturated fatty acids. Overall, 68% of PBAPs, 43% of processed and 75% of unprocessed animal-homologs had Nutri-Score ratings of A or B (most healthy). About 17% of PBAPs, 35% of processed and 13% of unprocessed animal-based food were in Nutri-Score categories D or E (least healthy). Dairy, fish, and meat alternatives had lower FSAm-NPS scores (most healthy), while cheese alternatives scored higher (least healthy) than animal-based homologs. Unprocessed fish and meat were healthier than similar PBAPs based on FSAm-NPS criteria. Approximately 37% of PBAPs and 72% of processed animal-based products were ultra-processed food (NOVA group 4). Within the ultra-processed food group, Nutri-Score varied widely.

    CONCLUSIONS: Most PBAPs had better nutrient profile than animal-based homologs. However, cheese, fish and meats PBAPs had poorer nutrient profile and were more processed. Given the high degree of processing and variable nutritional profile, PBAPs require a multi-dimensional evaluation of their health impact.

    Matched MeSH terms: Meat*
  15. Fulltext Bleeding Efficiency, Microbiological Quality and Oxidative Stability of Meat from Goats Subjected to Slaughter without Stunning in Comparison with Different Methods of Pre-Slaughter Electrical Stunning
    Sabow AB, Zulkifli I, Goh YM, Ab Kadir MZ, Kaka U, Imlan JC, et al.
    PLoS One, 2016;11(4):e0152661.
    PMID: 27035716 DOI: 10.1371/journal.pone.0152661
    The influence of pre-slaughter electrical stunning techniques and slaughter without stunning on bleeding efficiency and shelf life of chevon during a 14 d postmortem aging were assessed. Thirty two Boer crossbred bucks were randomly assigned to four slaughtering techniques viz slaughter without stunning (SWS), low frequency head-only electrical stunning (LFHO; 1 A for 3 s at a frequency of 50 Hz), low frequency head-to-back electrical stunning (LFHB; 1 A for 3 s at a frequency of 50 Hz) and high frequency head-to-back electrical stunning (HFHB; 1 A for 3 s at a frequency of 850 Hz). The SWS, LFHO and HFHB goats had higher (p<0.05) blood loss and lower residual hemoglobin in muscle compared to LFHB. The LFHB meat had higher (p<0.05) TBARS value than other treatments on d 7 and 14 d postmortem. Slaughtering methods had no effect on protein oxidation. Higher bacterial counts were observed in LFHB meat compared to those from SWS, LFHO and HFHB after 3 d postmortem. Results indicate that the low bleed-out in LFHB lowered the lipid oxidative stability and microbiological quality of chevon during aging.
    Matched MeSH terms: Meat Products/microbiology*
  16. Fulltext Are spiritual, ethical, and eating qualities of poultry meat influenced by current and frequency during electrical water bath stunning?
    Hayat MN, Kumar P, Sazili AQ
    Poult Sci, 2023 Sep;102(9):102838.
    PMID: 37392488 DOI: 10.1016/j.psj.2023.102838
    With the continuous rise of Muslim and Jewish populations and their increasing preference for ritually slaughtered poultry meat, the industry is forced to redefine its existing product-centric quality standard toward a new consumer-centric dimension of quality. The new dimension is mainly attributed to ensuring animal welfare and ethical treatment (ethical quality), spiritual quality (such as halal status, cleanliness), and eating quality standards set by religion. To meet consumer quality requirements while maintaining high production performance, the industry has incorporated newer technologies that are compatible with religious regulations such as stunning methods like electrical water bath stunning. However, the introduction of new techniques such as electrical water bath stunning has been met with mixed reactions. Some religious scholars have banned the use of any stunning methods in religious slaughter, as halal status is believed to be compromised in cases where birds have been stunned to death before slaughter. Nevertheless, some studies have shown the positive side of the electrical water bath stunning procedure in terms of preserving eating, ethical, and spiritual quality. Therefore, the present study aims to critically analyze the application of various aspects of electrical water bath stunning such as current intensity and frequency on various quality attributes, namely, ethical, spiritual, and eating quality of poultry meat.
    Matched MeSH terms: Meat/analysis
  17. Fulltext Physicochemical and sensory characteristics of burger made from duck surimi-like material
    Ramadhan K, Huda N, Ahmad R
    Poult Sci, 2012 Sep;91(9):2316-23.
    PMID: 22912469 DOI: 10.3382/ps.2011-01747
    Burgers were prepared using duck surimi-like material (DSLM) with polydextrose added (SL) and DSLM with sucrose-sorbitol added (SS), and the properties of these burgers were compared with those of burgers made of chicken meat (CB) and duck meat (DB). Quality characteristics such as chemical composition, cooking loss, diameter shrinkage, color, and texture were measured. The DB had a lower moisture content (55.58%) and higher fat content (21.44%) and cooking loss (11.01%) compared with other samples, whereas CB, SS, and SL did not differ significantly in moisture (65.21-66.10%) and fat (10.42-11.16%) content or cooking loss (5.32-6.15%). The SS and SL were positioned below CB and above DB in terms of hardness, chewiness, and springiness. Ten trained panelists assessed the burgers using quantitative descriptive analysis. Among the burgers, CB had the greatest brightness of color, hardness, springiness, and chewiness. The SS had greater sweetness than the other burgers. Both SL and SS had significantly less animalic odor, meaty flavor, oiliness, juiciness, and saltiness compared with DB. The physicochemical and sensory characteristics of burgers prepared from DSLM approached those of burgers made of chicken.
    Matched MeSH terms: Meat Products/analysis; Meat Products/standards*
  18. Fulltext Omics-Based Analytical Approaches for Assessing Chicken Species and Breeds in Food Authentication
    Dirong G, Nematbakhsh S, Selamat J, Chong PP, Idris LH, Nordin N, et al.
    Molecules, 2021 Oct 28;26(21).
    PMID: 34770913 DOI: 10.3390/molecules26216502
    Chicken is known to be the most common meat type involved in food mislabeling and adulteration. Establishing a method to authenticate chicken content precisely and identifying chicken breeds as declared in processed food is crucial for protecting consumers' rights. Categorizing the authentication method into their respective omics disciplines, such as genomics, transcriptomics, proteomics, lipidomics, metabolomics, and glycomics, and the implementation of bioinformatics or chemometrics in data analysis can assist the researcher in improving the currently available techniques. Designing a vast range of instruments and analytical methods at the molecular level is vital for overcoming the technical drawback in discriminating chicken from other species and even within its breed. This review aims to provide insight and highlight previous and current approaches suitable for countering different circumstances in chicken authentication.
    Matched MeSH terms: Meat/analysis*; Meat/standards*
  19. Producing selenium-enriched eggs and meat to improve the selenium status of the general population
    Fisinin VI, Papazyan TT, Surai PF
    Crit Rev Biotechnol, 2009;29(1):18-28.
    PMID: 19514900 DOI: 10.1080/07388550802658030
    The role of selenium (Se) in human health and diseases has been discussed in detail in several recent reviews, with the main conclusion being that selenium deficiency is recognised as a global problem which urgently needs resolution. Since selenium content in plant-based food depends on its availability from soil, the level of this element in food and feeds varies among regions. In general, eggs and meat are considered to be good sources of selenium in human diet. When considering ways to improve human selenium intake, there are several potential options. These include direct supplementation, soil fertilisation and supplementation of food staples such as flour, and production of functional foods. Analysing recent publications related to functional food production, it is evident that selenium-enriched eggs can be used as an important delivery system of this trace mineral for humans. In particular, developments and commercialisation of organic forms of selenium have initiated a new era in the availability of selenium-enriched products. It has been shown that egg selenium content can easily be manipulated to give increased levels, especially when organic selenium is included in hens' diet at levels that provide 0.3-0.5 mg/kg selenium in the feed. As a result, technology for the production of eggs delivering approximately 50% (30-35 microg) of the human selenium RDA have been developed and successfully tested. Currently companies all over the world market selenium-enriched eggs including the UK, Ireland, Mexico, Columbia, Malaysia, Thailand, Australia, Turkey, Russia and the Ukraine. Prices for enriched eggs vary from country to country, typically being similar to free-range eggs. Selenium-enriched chicken, pork and beef can also be produced when using organic selenium in the diet of poultry and farm animals. The scientific, technological and other advantages and limitations of producing designer/modified eggs as functional foods are discussed in this review.
    Matched MeSH terms: Meat*
  20. Modified use of methylene blue in the tissue compression technique to detect sarcocysts in meat-producing animals
    Ng YH, Subramaniam V, Lau YL
    Vet Parasitol, 2015 Nov 30;214(1-2):200-3.
    PMID: 26455572 DOI: 10.1016/j.vetpar.2015.09.032
    Sarcocystosis in meat-producing animals is a major cause of reduced productivity in many countries, especially those that rely on agriculture. Although several diagnostic methods are available to detect sarcocystosis, many are too time-consuming for routine use in abattoirs and meat inspection centers, where large numbers of samples need to be tested. This study aimed to compare the sensitivity of the methylene blue tissue preparation, unstained tissue preparation and nested PCR in the detection of sarcocysts in tissue samples. Approximately three-fold more sarcocysts were detected in methylene blue-stained tissue compared to unstained controls (McNemar's test: P<0.01). Test sensitivity was comparable to that of the gold standard for sarcocyst detection, nested polymerase chain reaction. These results suggest that methylene blue can be used in tissue compression as a rapid, safe, and inexpensive technique for the detection of ruminant sarcocystosis in abattoirs.
    Matched MeSH terms: Meat; Meat Products
Related Terms
Filters
Contact Us

Please provide feedback to Administrator ([email protected])

External Links