BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
This report describes the MalariaGEN Pv4 dataset, a new release of curated genome variation data on 1,895 samples of Plasmodium vivax collected at 88 worldwide locations between 2001 and 2017. It includes 1,370 new samples contributed by MalariaGEN and VivaxGEN partner studies in addition to previously published samples from these and other sources. We provide genotype calls at over 4.5 million variable positions including over 3 million single nucleotide polymorphisms (SNPs), as well as short indels and tandem duplications. This enlarged dataset highlights major compartments of parasite population structure, with clear differentiation between Africa, Latin America, Oceania, Western Asia and different parts of Southeast Asia. Each sample has been classified for drug resistance to sulfadoxine, pyrimethamine and mefloquine based on known markers at the dhfr, dhps and mdr1 loci. The prevalence of all of these resistance markers was much higher in Southeast Asia and Oceania than elsewhere. This open resource of analysis-ready genome variation data from the MalariaGEN and VivaxGEN networks is driven by our collective goal to advance research into the complex biology of P. vivax and to accelerate genomic surveillance for malaria control and elimination.
The goal to eliminate malaria from the Asia-Pacific by 2030 will require the safe and widespread delivery of effective radical cure of malaria. In October 2017, the Asia Pacific Malaria Elimination Network Vivax Working Group met to discuss the impediments to primaquine (PQ) radical cure, how these can be overcome and the methodological difficulties in assessing clinical effectiveness of radical cure. The salient discussions of this meeting which involved 110 representatives from 18 partner countries and 21 institutional partner organizations are reported. Context specific strategies to improve adherence are needed to increase understanding and awareness of PQ within affected communities; these must include education and health promotion programs. Lessons learned from other disease programs highlight that a package of approaches has the greatest potential to change patient and prescriber habits, however optimizing the components of this approach and quantifying their effectiveness is challenging. In a trial setting, the reactivity of participants results in patients altering their behaviour and creates inherent bias. Although bias can be reduced by integrating data collection into the routine health care and surveillance systems, this comes at a cost of decreasing the detection of clinical outcomes. Measuring adherence and the factors that relate to it, also requires an in-depth understanding of the context and the underlying sociocultural logic that supports it. Reaching the elimination goal will require innovative approaches to improve radical cure for vivax malaria, as well as the methods to evaluate its effectiveness.