MyMedR

Displaying all 8 publications

Abstract:

Sort:

Prevalence of neuromyelitis optica spectrum disorder in the multi-ethnic Penang Island, Malaysia, and a review of worldwide prevalence

Hor JY, Lim TT, Chia YK, Ching YM, Cheah CF, Tan K, et al.

Mult Scler Relat Disord, 2018 Jan;19:20-24.
PMID: 29100047 DOI: 10.1016/j.msard.2017.10.015

BACKGROUND: Neuromyelitis optica spectrum disorder (NMOSD) occurs worldwide in all ethnicities. Recently, population-based studies have shown that NMOSD is more common among non-White populations. There is scarce data about NMOSD prevalence in South East Asian populations.
METHODS: (1) A population-based study was undertaken to estimate NMOSD prevalence in the multi-ethnic Penang Island, Malaysia, comprising Chinese, Malays, and Indians. Medical records of NMOSD patients followed up at the Penang General Hospital (the neurology referral centre in Penang Island) were reviewed. The 2015 diagnostic criteria of the International Panel for NMO Diagnosis were used for case ascertainment. (2) A review of population-based prevalence studies of NMOSD worldwide was carried out. PubMed and conference proceedings were searched for such studies.
RESULTS: Of the 28 NMOSD patients, 14 were residents of Penang Island on prevalence day [13 (93%) Chinese and one (7%) Malay]. All 14 patients were females and aquaporin 4 seropositive. The prevalence of NMOSD in Penang Island was 1.99/100,000 population; according to ethnicities, the prevalence in Chinese was significantly higher than in Malays (3.31/100,000 vs 0.43/100,000, respectively, p = 0.0195).
CONCLUSION: Based on our and other population-based studies, among Asians, East Asian origin populations (Chinese and Japanese) appear to have higher NMOSD prevalence than other Asian ethnic groups. Worldwide, Blacks seem to have the highest NMOSD prevalence. More studies in different geographical regions and ethnic groups will be useful to further inform about potential factors in NMOSD pathogenesis.

Matched MeSH terms: Continental Population Groups/ethnology*
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Population Groups/ethnology
Attitudes toward epilepsy in East Malaysia using the Public Attitudes Toward Epilepsy (PATE) scale

Chia ZJ, Lim KS, Fong SL, Sim RS, Rajahram GS, Narayanan V, et al.

Epilepsy Behav, 2020 09;110:107158.
PMID: 32512367 DOI: 10.1016/j.yebeh.2020.107158

BACKGROUND: Epilepsy stigma is an important issue affecting people with epilepsy (PWE) in various social aspects of life. Most studies on stigma were among the metropolitan population but rarely on indigenous people. Hence, this study aimed to understand the attitudes toward epilepsy of the East Malaysians, comparing with the West Malaysians previously reported.
METHOD: This study was performed among the indigenous people in Kuching and Sibu (Sarawak) and Kota Kinabalu (Sabah) using the Public Attitudes Toward Epilepsy (PATE) scale. A higher score indicates poorer attitude.
RESULT: A total of 360 respondents (41.7% Kadazan-Dusun, 30.6% Bidayuh, and 24.7% Iban) aged 34.6 ± 12.6 years completed the questionnaire. They were predominantly females and had lower education level and income compared with the West Malaysians. The Sabah population had significantly lower mean scores (better attitudes) than those in Sarawak, in both personal and general domains (p 

Matched MeSH terms: Population Groups/ethnology*
Herbal medicines: predictors of recommendation by physicians

Aziz Z

J Clin Pharm Ther, 2004 Jun;29(3):241-6.
PMID: 15153085

We hypothesized that as the use of herbal medicines increases in the general population, so do patients' requests to physicians for recommendations. However, why some physicians recommend herbal medicines while others do not is not well understood.

Matched MeSH terms: Continental Population Groups/ethnology
The population genomic landscape of human genetic structure, admixture history and local adaptation in Peninsular Malaysia

Deng L, Hoh BP, Lu D, Fu R, Phipps ME, Li S, et al.

Hum Genet, 2014 Sep;133(9):1169-85.
PMID: 24916469 DOI: 10.1007/s00439-014-1459-8

Peninsular Malaysia is a strategic region which might have played an important role in the initial peopling and subsequent human migrations in Asia. However, the genetic diversity and history of human populations--especially indigenous populations--inhabiting this area remain poorly understood. Here, we conducted a genome-wide study using over 900,000 single nucleotide polymorphisms (SNPs) in four major Malaysian ethnic groups (MEGs; Malay, Proto-Malay, Senoi and Negrito), and made comparisons of 17 world-wide populations. Our data revealed that Peninsular Malaysia has greater genetic diversity corresponding to its role as a contact zone of both early and recent human migrations in Asia. However, each single Orang Asli (indigenous) group was less diverse with a smaller effective population size (N(e)) than a European or an East Asian population, indicating a substantial isolation of some duration for these groups. All four MEGs were genetically more similar to Asian populations than to other continental groups, and the divergence time between MEGs and East Asian populations (12,000--6,000 years ago) was also much shorter than that between East Asians and Europeans. Thus, Malaysian Orang Asli groups, despite their significantly different features, may share a common origin with the other Asian groups. Nevertheless, we identified traces of recent gene flow from non-Asians to MEGs. Finally, natural selection signatures were detected in a batch of genes associated with immune response, human height, skin pigmentation, hair and facial morphology and blood pressure in MEGs. Notable examples include SYN3 which is associated with human height in all Orang Asli groups, a height-related gene (PNPT1) and two blood pressure-related genes (CDH13 and PAX5) in Negritos. We conclude that a long isolation period, subsequent gene flow and local adaptations have jointly shaped the genetic architectures of MEGs, and this study provides insight into the peopling and human migration history in Southeast Asia.

Matched MeSH terms: Population Groups/ethnology
The influence of ethnicity on health-related quality of life in diabetes mellitus: a population-based, multiethnic study

Wee HL, Li SC, Cheung YB, Fong KY, Thumboo J

J Diabetes Complications, 2006;20(3):170-8.
PMID: 16632237 DOI: 10.1016/j.jdiacomp.2005.06.010

OBJECTIVES: The aims of this study were to evaluate the influence of ethnicity on health-related quality of life (HRQoL) in diabetic participants using both profile [the Short-Form 36 (SF-36)] and single-index (the SF-6D) instruments and to evaluate the usefulness of the SF-6D as a summary measure for the SF-36.
RESEARCH DESIGN AND METHODS: Using data from a cross-sectional, population-based survey of Chinese, Malay, and Indians in Singapore, we analyzed the influence of ethnicity and other variables on each SF-36 scale and SF-6D scores using linear regression models to adjust for the influence of known determinants of HRQoL.
RESULTS: Data from 309 diabetic respondents were analyzed. Compared with other ethnicities, Indians were most likely to report impaired HRQoL. The unadjusted influence of ethnicity on HRQoL exceeded the minimum clinically important difference (MCID) for all SF-36 scales (MCID: 5 points) and the SF-6D (MCID: 0.033 points). After adjusting for gender, age, and education, the influence of Chinese ethnicity exceeded the MCID for all SF-36 scales, except vitality (VT) and mental health (MH), as well as for the SF-6D. The influence of Malay ethnicity exceeded the MCID only for the SF-36 MH scale and the SF-6D. The influence of ethnicity on HRQoL persisted after adjusting further for other determinants of HRQoL. The SF-6D reflected the ethnic trends for some but not all SF-36 scales.
CONCLUSIONS: After adjusting for demographic, socioeconomic, and other factors known to influence HRQoL, ethnicity remained an important factor influencing HRQoL in this population-based multiethnic sample of diabetic Asians. Further studies to identify modifiable factors explaining the ethnic disparities in HRQoL among diabetic participants are needed. The SF-6D may be a useful summary measure for the SF-36.

Matched MeSH terms: Population Groups/ethnology
Fulltext A review of Orang Asli newborns admitted to a neonatal unit in a Malaysian general hospital

Kandasamy Y, Somasundram P

Singapore Med J, 2007 Oct;48(10):926-8.
PMID: 17909678

The Orang Asli are the indigenous population in peninsular Malaysia and are in fact a diverse sub-ethnic group with different languages. Our aim was to collect data on Orang Asli newborns, from western and central Pahang, that were admitted to a general hospital with paediatric specialist services.

Matched MeSH terms: Population Groups/ethnology
Admissions with atrial fibrillation in a multiracial population in Kuala Lumpur, Malaysia

Freestone B, Rajaratnam R, Hussain N, Lip GY

Int J Cardiol, 2003 Oct;91(2-3):233-8.
PMID: 14559136

BACKGROUND: There are established differences in cardiovascular disease in different racial groups. Worldwide, the literature regarding the clinical epidemiology of atrial fibrillation in non-white populations is scarce.
OBJECTIVES: To document the prevalence of atrial fibrillation (AF) in the multiracial population of Malaysia, and to describe the clinical features and management of these patients.
SETTING: Busy city centre general hospital in Kuala Lumpur, Malaysia, over a 1-month period.
SUBJECTS: One-thousand four hundred and thirty-five acute medical admissions, of whom 40 patients (2.8%) had AF.
RESULTS: Of 1435 acute medical admissions to Kuala Lumpur General Hospital over the 4-week study period, 40 had AF (21 male, 19 female; mean age 65 years). Of these, 18 were Malay, 16 Chinese and six Indian. Nineteen patients had previously known AF (seven with paroxysmal AF) and 21 were newly diagnosed cases. The principal associated medical conditions were ischaemic heart disease (42.5%), hypertension (40%) and heart failure (40%). Dyspnoea was the commonest presentation, whilst stroke was the cause of presentation in only two patients. Investigations were under-utilised, with chest X-ray and echocardiography in only 62.5% of patients and thyroid function checked in 15%. Only 16% of those with previously diagnosed AF were on warfarin, with a further three on aspirin. Anticoagulant therapy was started in 13.5% of patients previously not on warfarin, and aspirin in 8%. Records of contraindications to warfarin were unreliable, being identified in only 25%. For those with known AF, 58% were on digoxin. For new onset AF, digoxin was again the most common rate-limiting treatment, initiated in 38%, whilst five patients with new onset AF were commenced on amiodarone. DC cardioversion was not used in any of the patients with new onset AF.
CONCLUSION: Amongst acute medical admissions to a single centre in Malaysia the prevalence of AF was 2.8%. Consistent with previous similar surveys in mainly western (caucasian) populations, standard investigations in this Malaysian cohort were also inadequate and there was underuse of anticoagulation, medication for ventricular rate control and cardioversion to sinus rhythm.

Matched MeSH terms: Continental Population Groups/ethnology*