MyMedR

Displaying all 2 publications

Abstract:

Sort:

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext Observational study on the current status of thalassaemia in Malaysia: a report from the Malaysian Thalassaemia Registry

Mohd Ibrahim H, Muda Z, Othman IS, Mohamed Unni MN, Teh KH, Thevarajah A, et al.

BMJ Open, 2020 06 29;10(6):e037974.
PMID: 32601117 DOI: 10.1136/bmjopen-2020-037974

OBJECTIVE: Thalassaemia is the most common inherited blood disorder in Malaysia. This study aims to report the current status of thalassaemia in Malaysia and provide a comprehensive understanding of the disease through data obtained from the Malaysian Thalassaemia Registry.
DESIGN: Data were extracted from the Malaysian Thalassaemia Registry, a web-based system accessible to enrolled users through www.mytalasemia.net.my.
SETTING: The Malaysian Thalassaemia Registry data was recorded from reports obtained from 110 participating government and university hospitals in Malaysia.
PARTICIPANTS: The patients were those attending the 110 participating hospitals for thalassaemia treatment.
INTERVENTION: Data were collected from the Malaysian Thalassaemia Registry from 2007 until the fourth quarter of 2018.
PRIMARY OUTCOME MEASURE: 7984 out of 8681 patients with thalassaemia registered in the Malaysian Thalassaemia Registry were reported alive.
RESULTS: Majority of the patients were reported in the state of Sabah (22.72%); the largest age group affected was 5.0-24.9 years old (64.45%); the largest ethnic group involved was Malay (63.95%); and the major diagnosis was haemoglobin E/β-thalassaemia (34.37%). From the 7984 patients, 56.73% were on regular blood transfusions and 61.72% were on chelation therapy. A small fraction (14.23%) has undergone splenectomy, while the percentage of patients with severe iron overload (serum ferritin ≥5000 µg/L) reduced over time. However, cardiac complications are still the main cause of death in patients with thalassaemia.
CONCLUSION: Data gathered into the registry can be used to understand the progression of the disorder, to monitor iron overload management and to improve the outcomes of treatment, to enhance preventive strategies, reduce healthcare burden and improve the quality of life. Sustainability of the Malaysian Thalassaemia Registry is important for surveillance of thalassaemia management in the country and help the national health authorities to develop more effective policies.

Filters

Please provide feedback to Administrator ([email protected])

External Links