Malignant neoplasms diagnosed histologically in the state of Sabah during the period November 1983 to October 1988 were analysed to determine the distribution of malignant neoplasms according to site, age, sex and major ethnic groups. The five commonest malignant neoplasms in males were carcinomas of the nasopharynx, stomach, skin, lung and liver. In females the five commonest malignant neoplasms were carcinomas of the cervix uteri, breast, ovary, thyroid and skin. There was variation in these frequencies among the major ethnic groups. The most striking of these was the high frequency of nasopharyngeal carcinoma among Kadazan and Chinese males but not in males of the other indigenous groups. A significant number of patients with nasopharyngeal carcinoma was found in the younger age groups and most of the patients in the younger age groups were Kadazans. A relatively high frequency of carcinoma of the stomach, skin and liver was seen among Kadazans and other indigenous groups while carcinoma of the lung was seen relatively frequently among Chinese males. Among females carcinomas of the breast and cervix uteri were the most frequent malignant neoplasms in all the main ethnic groups. Possible reasons for these findings are discussed.
Immunophenotypic studies using immunofluorescent flow cytometry were performed on the blast cells of 36 patients with acute leukaemia using a panel of eight monoclonal antibodies. Six patients had blasts which co-expressed markers for lymphoid and myeloid differentiation, and which were therefore defined as biphenotypic hybrid acute leukaemia. Of the six, three patients were in the paediatric age group (below 12 years old) while the other three were more than 12 years old. Peripheral blood counts were variable; however, bone marrow infiltration was extensive (blasts > or = 75% in all). At the time of study, remission was achieved in only two patients. The authors' data show that biphenotypic hybrid acute leukaemia is not rare in Malaysia. This represents a subgroup of acute leukaemia identifiable by immunophenotyping but not by the French-American-British classification based on morphological and basic cytochemical studies alone. The recognition of this subgroup is important for both practical and theoretical reasons. There are implications for treatment of the individual patient because treatment directed at a single lineage may not be effective. The two colour flow cytometry proved to be a useful tool for diagnosis and classification of acute leukaemia.
PIP: Long term use of low doses of combination oral contraceptives appears to increase plasminogen level, thereby increasing fibrinolytic activity and reducing the risk of thromboembolism. Blood levels of plasminogen, tissue plasminogen activator (tPA), and plasminogen activator inhibitor (PAI), were measured before and after stress (5 minutes of stair climbing) in a group of 30 women, 23-40 years old, who had taken 30 mcg of ethinyl estradiol with 150 mcg of desogestrel or levonorgestrel for at least 1 year. Similar measurements were taken from a control group of 30 women matched for age, height, and weight. Plasminogen and tPA levels in both groups increased significantly after exercise. The level of PAI did not change significantly with stress in either group. The level of plasminogen was significantly higher in the group taking contraceptives, whether before or after exercise, when compared to the control group. Levels of tPA and PAI, although slightly increased in the oral contraceptive group, were not significantly different between the two groups. The increase in plasminogen may be due to the estrogen component of the contraceptives. Stress seems to increase fibrinolytic response.
Lymphoma is a highly heterogeneous group of malignant disease. This study aimed to elucidate the pattern of lymphoma in the East Malaysian patient population. 107 cases of confirmed lymphomas from East Malaysian biopsy material were retrieved from the files of the Department of Pathology, University of Malaya, in the 3-year period between 1981 to 1983. With the use of a panel of lymphoid antibodies, the disease was sub-classified using the Rye classification for Hodgkin's lymphoma (HL) and the REAL classification for non-Hodgkin's lymphoma (NHL). All of the cases were tested for the presence of the Epstein-Barr virus by EBER-ISH. There were 11 (10.3%) HL, 80 (74.7%) B-NHL and 16 (15%) T-NHL. The HL:NHL ratio was 1:9. The most common tumour in children was Burkitt's lymphoma 7/13 (53.8%). In the adult group, there were 72/94 (76.6%) B-NHL ¿diffuse large cell type 51 (of which 2 were CD30+), Burkitt's lymphoma 8, follicular lymphoma 5, low grade MALT 2, mantle cell type 1 and not otherwise specified due to poor morphology 5¿, 13/94 (13.8%) T-NHL and 9/94 (9.6%) HL. Of the 9 adult HL, the most common subtype was nodular sclerosis (6, 66.7%). The EBER positive rate in classical HL, T-NHL, BL and B-NHL were 33.3%, 56.3%, 60.0% and 3.1% respectively. In conclusion, the spectrum of lymphoma seen in East Malaysia was rather similar to West Malaysia except for the very low prevalence of peripheral T-cell lymphoma (PTCL) in Sarawak (3.3%).
INTRODUCTION:
This study was carried out among undergraduate students in Universiti Malaysia Sarawak with the objective of examining gender differences in body mass index (BMI), body weight perception, eating attitudes and weightloss strategies.
METHODS:
Subjects consisted of 600 undergraduates (300 males and 300 females) recruited from the various faculties between September 2008 until mid-November 2008. The Original Figure Rating Scale: Body Weight Perception, Body Shape Questionnaire (BSQ) and Eating Attitudes Test-26 (EAT-26) were used as assessment tools.
RESULTS:
Overall, 52.8% of students had normal BMI, with approximately an equal number of both sexes. More males than females were overweight (33.7%), while more females were underweight (25.3%). Males were more likely to perceive themselves as overweight, and fail to see themselves as underweight. More than half of the females preferred their ideal figure to be underweight, whereas about 30% males chose an overweight figure as their ideal model. Females were generally more concerned about body weight, body shape and eating than males. They diet more frequently, had self-induced vomiting, and used laxatives and exercise as their weight-loss strategies.
CONCLUSION:
Issues pertaining to body weight perception, eating attitudes and weight-loss strategies exist with differences among male and female undergraduates. Thus, in order to correct misperceptions among young adults, a more tailored intervention programme and more in-depth studies into the various factors involved are required
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Cancer is a major morbidity and mortality concern in Malaysia. Based on National Cancer Registry data, the Malaysian population is estimated to bear a cancer burden of about 40,000 new cases per year, and a cumulative lifetime risk of about 1:4. Cancer research in Malaysia has to consider needs relevant to our population, and resources constraints. Hence, funding bodies prioritise cancers of high prevalence, unique to our community and posing specific clinical problems. Cancer diagnosis is crucial to cancer management. While cancer diagnosis research largely aims at improvements in diagnostic information towards more appropriate therapy, it also impacts upon policy development and other areas of cancer management. The scope of cancer diagnosis upon which this paper is based, and their possible impact on other R&D areas, has been broadly categorized into: (1) identification of aetiological agents and their linkages to the development of precancer and cancer (impact on policy development, cancer prevention and treatment), (2) cancer biology and pathogenesis (impact on cancer prevention, treatment strategies and product development), (3) improvements in accuracy, sensitivity and specificity in cancer detection, monitoring and classification (impact on technology development) and (4) prognostic and predictive parameters (impact on treatment strategies). This paper is based on data collected by the Working Group on Cancer Diagnosis Research for the First National Conference on Cancer Research Coordination in April 2004. Data was collated from the databases of Institutions/Universities where the authors are employed, the Ministry of Science, Technology and Innovation (MOSTI) and targeted survey feedback from key cancer researchers. Under the 7th Malaysia Plan, 76 cancer projects were funded through the Intensified Research in Priority Areas (IRPA) scheme of MOSTI, amounting to almost RM15 million of grant money. 47(61.8%) of these projects were substantially in cancer diagnosis, accounting for 65.6% (RM 9.7 million) of cancer project funds. The 8th Malaysia Plan saw a change in research strategy. The IRPA agency fielded several top-down projects which encouraged a multicentre and multidisciplinary approach. This resulted in larger funding per project i.e. RM32 million for 49 projects. There was also a surge of interest in drug development and natural products. Because of this shift in direction, cancer diagnosis projects constituted only 51% of IRPA-funded cancer projects. Nonetheless funding for cancer diagnosis research has exceeded that of the 7th Malaysia Plan, being RM12.5 million by March 2004. The majority of such research is carried out at the Universities, engaging a large number of young scientists and postgraduate students (51 MSc and 21 PhD). A lot of research findings presented at scientific meetings have not yet been published and there is a glaring shortage of patents and commercialization of research findings (such as creation of test kits). Because diagnosis is very much a part of clinical practice, many researchers felt satisfied and confident that their work will be translated into practice and will significantly improve diagnostic services in Malaysia. National guidelines and consensus development on at least three malignancies i.e. breast cancer, oral cancer and lymphoma, have substantial basis in local R&D work. Problems encountered in research included (1) insufficient funding to realize research objectives, (2) lack of local expertise (most research assistants are inexperienced BSc graduates with no or minimal research experience), (3) inadequate technical support from vendors during equipment failure, (4) inexperienced Institutional development units to assist in product development, (5) lack of venture capital for commercialization of findings, and (6) inadequate incentives to undertake research. Researchers pointed out that plans to promote research should include the establishment of (1) regional and national cancer tissue banks, (2) a National Cancer Research Institute, (3) a dedicated cancer research fund, (4) a registry of cancer researchers, (5) national research coordinators, (6) improved coverage by the National Cancer Registry, (7) more international collaboration, (8) a better career structure for researchers, (9) improved Institutional support for product realization, and (10) better recognition for cancer researchers.