Displaying publications 61 - 80 of 268 in total

Abstract:
Sort:
  1. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication
    Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Food Contamination/analysis
  2. Toxicity assessment of heavy metals translocation in maize grown in the Ganges delta floodplain soils around the Payra power plant in Bangladesh
    Islam MS, Al Bakky A, Ahmed S, Islam MT, Antu UB, Saikat MSM, et al.
    Food Chem Toxicol, 2024 Nov;193:115005.
    PMID: 39284411 DOI: 10.1016/j.fct.2024.115005
    As a cereal crop, maize ranked third place after wheat and rice in terms of land area coverage for its cultivation, and in Bangladesh, it ranked second place after rice in its production. As the substitution of wheat products, maize has been used widely in baking for human consumption and animal fodder. However, maize grown in this soil around the coal-burning power plant may cause heavy metals uptake that poses a risk to humans. The study was conducted at the maize fields in the Ganges delta floodplain soils of Bangladesh to know the concentration of eight heavy metals (Ni, Cr, Cd, Mn, As, Cu, Zn, and Pb) in soil and maize samples using an inductively coupled plasma mass spectrometer (ICP-MS) and to estimate the risk of heavy metals in maize grains. Mean concentrations of heavy metals (mg/kg) in soil were in decreasing order of Zn (10.12) > Cu (10.02) > Mn (5.48) > Ni (4.95) > Cr (3.72) > As (0.51) > Pb (0.27) > Cd (0.23). The plant tissues showed the descending order of heavy metal concentration as roots > grains > stems > leaves. BCF values for As, Cd, Pb, and Mn in roots were higher than 1.0, indicating considerable accumulation of these elements in maize via roots. Total hazard quotient (ƩTHQ) of heavy metals through maize grain consumption was 3.7E+00 and 3.9E+00 for adults and children, respectively, indicating non-cancer risk to the consumers. Anthropogenic influences contributed to the heavy metals enrichment in the Ganges delta floodplain soils around the thermal plant, and potential risks (non-carcinogenic and carcinogenic) were observed due to the consumption of maize grain cultivated in the study area.
    Matched MeSH terms: Food Contamination/analysis
  3. Norovirus cross-contamination during food handling and interruption of virus transfer by hand antisepsis: experiments with feline calicivirus as a surrogate
    Bidawid S, Malik N, Adegbunrin O, Sattar SA, Farber JM
    J Food Prot, 2004 Jan;67(1):103-9.
    PMID: 14717359
    While there is good epidemiological evidence for foods as vehicles for norovirus transmission, the precise means of spread and its control remain unknown. The feline calicivirus was used as a surrogate for noroviruses to study infectious virus transfer between hands and selected types of foods and environmental surfaces. Assessment of the potential of selected topicals in interrupting such virus transfer was also made. Ten microliters of inoculum of feline calicivirus deposited onto each fingerpad of adult subjects was allowed to air dry and the contaminated area on individual fingerpads was pressed (10 s at a pressure of 0.2 to 0.4 kg/cm2) onto 1-cm-diameter disks of ham, lettuce, or brushed stainless steel. The virus remaining on the donor and that transferred to the recipient surfaces was eluted and plaque assayed. Virus transfer to clean hands from experimentally contaminated disks of ham, lettuce, and stainless steel was also tested. Nearly 46 +/- 20.3, 18 +/- 5.7, and 13 +/- 3.6% of infectious virus was transferred from contaminated fingerpads to ham, lettuce, and metal disks, respectively. In contrast, approximately 6 +/- 1.8, 14 +/- 3.5, and 7 +/- 1.9% virus transfer occurred, respectively, from ham, lettuce, and metal disks to hands. One-way analysis of variance test showed that pretreatment (washing) of the fingerpads either with water or with both topical agent and water significantly (P < 0.05) reduced virus transfer to < or = 0.9%, as compared with < or = 2.3 and < or = 3.4% transfer following treatments with either 75% (vol/vol) ethanol or a commercial hand gel containing 62% ethanol, respectively. Despite wide variations in virus transfer among the targeted items used, intervention agents tested reduced virus transfer significantly (P < 0.05) when compared with that without such treatments (71 +/- 8.9%). These findings should help in a better assessment of the potential for cross-contamination of foods during handling and also assist in developing more effective approaches to foodborne spread of norovirus infections.
    Matched MeSH terms: Food Contamination/analysis*; Food Contamination/prevention & control
  4. Dioxin-like polychlorinated biphenyls, polychlorinated dibenzo-p-dioxins, and polychlorinated dibenzofurans in seafood samples from Malaysia: estimated human intake and associated risks
    Leong YH, Gan CY, Majid MI
    Arch Environ Contam Toxicol, 2014 Jul;67(1):21-8.
    PMID: 24651928 DOI: 10.1007/s00244-014-0019-5
    A total of 127 and 177 seafood samples from Malaysia were analyzed for polychlorinated dibenzo-p-dioxins/dibenzofurans (PCDD/Fs) and dioxin-like polychlorinated biphenyls (dl-PCBs), respectively. The World Health Organization-toxic-equivalency quotients (WHO-TEQ) of PCDD/Fs varied from 0.13 to 1.03 pg TEQ g(-1), whereas dl-PCBs ranged from 0.33 to 1.32 pg TEQ g(-1). Based on food-consumption data from the global environment monitoring system-food contamination monitoring and assessment programme, calculated dietary exposures to PCDD/Fs and dl-PCBs from seafood for the general population in Malaysia were 0.042 and 0.098 pg TEQ kg(-1) body weight day(-1), respectively. These estimations were quite different from the values calculated using the Malaysian food-consumption statistics (average of 0.313 and 0.676 pg TEQ kg(-1) body weight day(-1) for PCDD/Fs and PCBs, respectively). However, both of the dietary exposure estimations were lower than the tolerable daily intake recommended by WHO. Thus, it is suggested that seafood from Malaysia does not pose a notable risk to the health of the average consumer.
    Matched MeSH terms: Food Contamination/analysis*; Food Contamination/statistics & numerical data
  5. Fulltext Authentication of Nigella sativa seed oil in binary and ternary mixtures with corn oil and soybean oil using FTIR spectroscopy coupled with partial least square
    Rohman A, Ariani R
    ScientificWorldJournal, 2013;2013:740142.
    PMID: 24319381 DOI: 10.1155/2013/740142
    Fourier transform infrared spectroscopy (FTIR) combined with multivariate calibration of partial least square (PLS) was developed and optimized for the analysis of Nigella seed oil (NSO) in binary and ternary mixtures with corn oil (CO) and soybean oil (SO). Based on PLS modeling performed, quantitative analysis of NSO in binary mixtures with CO carried out using the second derivative FTIR spectra at combined frequencies of 2977-3028, 1666-1739, and 740-1446 cm(-1) revealed the highest value of coefficient of determination (R (2), 0.9984) and the lowest value of root mean square error of calibration (RMSEC, 1.34% v/v). NSO in binary mixtures with SO is successfully determined at the combined frequencies of 2985-3024 and 752-1755 cm(-1) using the first derivative FTIR spectra with R (2) and RMSEC values of 0.9970 and 0.47% v/v, respectively. Meanwhile, the second derivative FTIR spectra at the combined frequencies of 2977-3028 cm(-1), 1666-1739 cm(-1), and 740-1446 cm(-1) were selected for quantitative analysis of NSO in ternary mixture with CO and SO with R (2) and RMSEC values of 0.9993 and 0.86% v/v, respectively. The results showed that FTIR spectrophotometry is an accurate technique for the quantitative analysis of NSO in binary and ternary mixtures with CO and SO.
    Matched MeSH terms: Food Contamination/analysis*; Food Contamination/prevention & control*
  6. Fulltext Heavy Metal contamination of Dietary Supplements products available in the UAE markets and the associated risk
    Jairoun AA, Shahwan M, Zyoud SH
    Sci Rep, 2020 11 02;10(1):18824.
    PMID: 33139833 DOI: 10.1038/s41598-020-76000-w
    A specific safety concern is the possibility that a dietary supplement could be contaminated with heavy metals. This research was undertaken to investigate the daily exposure levels of heavy metals in dietary supplements available in the UAE and to explore the factors associated with the contamination of dietary supplements with heavy metals. A total of 277 dietary supplement samples were collected from the UAE market and prepared for the analysis of selected heavy metal contamination. Inductively coupled plasma mass spectrometry (ICP-MS) was used to determine the presence of heavy metals. The average daily intake of cadmium was 0.73 μg [95% CI 0.61-0.85], compared to the acceptable daily intake (ADI) of 6 μg; the daily intake of lead was 0.85 μg [95% CI 0.62-1.07], compared to the acceptable daily intake (ADI) of 20 μg; and the daily intake of arsenic was 0.67 μg [95% CI 0.57-0.78], compared to the acceptable daily intake of 10 μg. Although the dietary supplements available in the UAE have low levels of heavy metal contamination, numerous individuals are consuming a number of different dietary supplements every day and thereby may experience a cumulative level of toxic exposure. Dietary supplements formulations (Categories), dosage forms and country of origin are strong determents of heavy metal contamination in dietary supplements products.
    Matched MeSH terms: Food Contamination/analysis*; Food Contamination/prevention & control*
  7. Fulltext Preliminary Large Scale Mitigation of 3-Monochloropropane-1, 2-diol (3-MCPD) Esters and Glycidyl Esters in Palm Oil
    Ramli MR, Tarmizi AHA, Hammid ANA, Razak RAA, Kuntom A, Lin SW, et al.
    J Oleo Sci, 2020 Aug 06;69(8):815-824.
    PMID: 32641608 DOI: 10.5650/jos.ess20021
    Approximately 900 tonne of crude palm oil (CPO) underwent washing using 5 to 10% hot water (90 to 95°C) at a palm oil mill. The aim of the CPO washing was to eliminate and/or reduce total chlorine content present in the conventional CPO, as it is known as the main precursor for the formation of 3-monochloropropane-1, 2-diol esters (3-MCPDE). By a simple hot water washing, more than 85% of the total chlorine was removed. However, washing did not have significant (p > 0.05) effect on other oil quality parameters such as the deterioration of bleachability index (DOBI), free fatty acid (FFA) content and diacylglycerol (DAG) content of the oil. The latter has been established as the main precursor for glycidyl esters (GE) formation. The treated CPO was then transported using tankers and further refined at a commercial refinery. Refining of washed CPO resulted in significantly (p < 0.05) lower formation of 3-MCPDE, but GE content remained slightly high. Post-treatment of refined oil significantly reduced the GE content (p < 0.05) to an acceptable level whilst almost maintaining the low 3-MCPDE level. The study has proven that water washing of CPO prior to refining and subsequent post-refining is so far the most effective way to produce good quality refined oil with considerably low 3-MCPDE and GE contents. Dry fractionation of refined palm oil showed these contaminants partitioned more into the liquid olein fraction compared to the stearin fraction.
    Matched MeSH terms: Food Contamination/analysis*; Food Contamination/prevention & control*
  8. Fulltext 1H-NMR-Based Metabolomics: An Integrated Approach for the Detection of the Adulteration in Chicken, Chevon, Beef and Donkey Meat
    Akhtar MT, Samar M, Shami AA, Mumtaz MW, Mukhtar H, Tahir A, et al.
    Molecules, 2021 Jul 30;26(15).
    PMID: 34361796 DOI: 10.3390/molecules26154643
    Meat is a rich source of energy that provides high-value animal protein, fats, vitamins, minerals and trace amounts of carbohydrates. Globally, different types of meats are consumed to fulfill nutritional requirements. However, the increasing burden on the livestock industry has triggered the mixing of high-price meat species with low-quality/-price meat. This work aimed to differentiate different meat samples on the basis of metabolites. The metabolic difference between various meat samples was investigated through Nuclear Magnetic Resonance spectroscopy coupled with multivariate data analysis approaches like principal component analysis (PCA) and orthogonal partial least square-discriminant analysis (OPLS-DA). In total, 37 metabolites were identified in the gluteal muscle tissues of cow, goat, donkey and chicken using 1H-NMR spectroscopy. PCA was found unable to completely differentiate between meat types, whereas OPLS-DA showed an apparent separation and successfully differentiated samples from all four types of meat. Lactate, creatine, choline, acetate, leucine, isoleucine, valine, formate, carnitine, glutamate, 3-hydroxybutyrate and α-mannose were found as the major discriminating metabolites between white (chicken) and red meat (chevon, beef and donkey). However, inosine, lactate, uracil, carnosine, format, pyruvate, carnitine, creatine and acetate were found responsible for differentiating chevon, beef and donkey meat. The relative quantification of differentiating metabolites was performed using one-way ANOVA and Tukey test. Our results showed that NMR-based metabolomics is a powerful tool for the identification of novel signatures (potential biomarkers) to characterize meats from different sources and could potentially be used for quality control purposes in order to differentiate different meat types.
    Matched MeSH terms: Food Contamination/analysis*; Food Contamination/prevention & control
  9. Simulation of improper food hygiene practices: A quantitative assessment of Vibrio parahaemolyticus distribution
    Malcolm TTH, Chang WS, Loo YY, Cheah YK, Radzi CWJWM, Kantilal HK, et al.
    Int J Food Microbiol, 2018 Nov 02;284:112-119.
    PMID: 30142576 DOI: 10.1016/j.ijfoodmicro.2018.08.012
    Kitchen mishandling practices contribute to a large number of foodborne illnesses. In this study, the transfer and cross-contamination potential of Vibrio parahaemolyticus from bloody clams to ready-to-eat food (lettuce) was assessed. Three scenarios were investigated: 1) direct cross-contamination, the transfer of V. parahaemolyticus from bloody clams to non-food contact surfaces (hands and kitchen utensils) to lettuce (via slicing), was evaluated; 2) perfunctory decontamination, the efficacy of two superficial cleaning treatments: a) rinsing in a pail of water, and b) wiping with a kitchen towel, were determined; and 3) secondary cross-contamination, the microbial transfer from cleaning residuals (wash water or stained kitchen towel) to lettuce was assessed. The mean of percent transfer rates through direct contact was 3.6%, and an average of 3.5% of total V. parahaemolyticus was recovered from sliced lettuce. The attempted treatments reduced the transferred population by 99.0% (rinsing) and 94.5% (wiping), and the relative amount of V. parahaemolyticus on sliced lettuce was reduced to 0.008%. V. parahaemolyticus exposure via secondary cross-contamination was marginal. The relative amount of V. parahaemolyticus recovered from washed lettuce was 0.07%, and the transfers from stained kitchen towel to lettuce were insubstantial. Our study highlights that V. parahaemolyticus was readily spread in the kitchen, potentially through sharing of non-food contact surfaces. Results from this study can be used to better understand and potentially raising the awareness of proper handling practices to avert the spread of foodborne pathogens.
    Matched MeSH terms: Food Contamination/analysis; Food Contamination/prevention & control*
  10. Cadmium content in rice and its daily intake in various countries
    Rivai IF, Koyama H, Suzuki S
    Bull Environ Contam Toxicol, 1990 Jun;44(6):910-6.
    PMID: 2354269
    Matched MeSH terms: Food Contamination
  11. Fulltext A Revisit to the Formation and Mitigation of 3-Chloropropane-1,2-Diol in Palm Oil Production
    Arris FA, Thai VTS, Manan WN, Sajab MS
    Foods, 2020 Nov 29;9(12).
    PMID: 33260330 DOI: 10.3390/foods9121769
    Process-based contaminants in food-particularly in vegetable oils-have been a topic of interest due to their potential health risk on humans. Oral consumption above the tolerable daily intake might result in health risks. Therefore, it is critical to correctly address the food contaminant issues with a proper mitigation plan, in order to reduce and subsequently remove the occurrence of the contaminant. 3-monochloropropane-1,3-diol (3-MCPD), an organic chemical compound, is one of the heat- and process-induced food contaminants, belonging to a group called chloropropanols. This review paper discusses the occurrence of the 3-MCPD food contaminant in different types of vegetable oils, possible 3-MCPD formation routes, and also methods of reduction or removal of 3-MCPD in its free and bound esterified forms in vegetable oils, mostly in palm oil due to its highest 3-MCPD content.
    Matched MeSH terms: Food Contamination
  12. Screening of the aflatoxin M1 metabolite in urine samples of residents in Terengganu, Malaysia
    Ahmad FN, Jamaluddin R, Esa NM
    Toxicon, 2020 Oct 30;186:120-125.
    PMID: 32771393 DOI: 10.1016/j.toxicon.2020.07.022
    A study was conducted to screen the occurrence and level of aflatoxin M1 (AFM1) in urine samples of 206 urban and rural residents in Terengganu, Malaysia. The level of AFM1 was quantified by competitive enzyme-linked immune-absorbent assay (ELISA). Of the 206 samples, 84 were positive for AFM1 (40.8%) in a range of 0.07-5.53 ng/ml (mean = 0.589 ng/ml). Residents of Terengganu are moderately exposed to AFM1. Age, ethnicity, marital status and employment status were associated with urinary level of AFM1. Subjects aged 30 years and above, non-Malays, married, and those unemployed had significantly higher levels of urinary AFM1 (p 
    Matched MeSH terms: Food Contamination
  13. Fulltext Physical characterization of the screen-printed carbon electrode surface using scanning electron micrograph
    Issa, R., Hamdan, N.A., Raj, A.S.S., Noh, M.F.M.
    ASM Science Journal, 2011;5(1):36-42.
    MyJurnal
    Researchers have developed and modified DNA biosensor techniques to provide a fast, simple and sensitive method for detection of human diseases, bacterial food contamination, forensic and environmental research. This study describes the physical characterization of screen-printed carbon electrodes using the scanning electron microscope.
    Matched MeSH terms: Food Contamination
  14. Rapid assessment of total MCPD esters in palm-based cooking oil using ATR-FTIR application and chemometric analysis
    Goh KM, Maulidiani M, Rudiyanto R, Wong YH, Ang MY, Yew WM, et al.
    Talanta, 2019 Jun 01;198:215-223.
    PMID: 30876552 DOI: 10.1016/j.talanta.2019.01.111
    The technique of Fourier transform infrared spectroscopy is widely used to generate spectral data for use in the detection of food contaminants. Monochloropropanediol (MCPD) is a refining process-induced contaminant that is found in palm-based fats and oils. In this study, a chemometric approach was used to evaluate the relationship between the FTIR spectra and the total MCPD content of a palm-based cooking oil. A total of 156 samples were used to develop partial least squares regression (PLSR), artificial neural network (nnet), average artificial neural network (avNNET), random forest (RF) and cubist models. In addition, a consensus approach was used to generate fusion result consisted from all the model mentioned above. All the models were evaluated based on validation performed using training and testing datasets. In addition, the box plot of coefficient of determination (R2), root mean square error (RMSE), slopes and intercepts by 100 times randomization was also compared. Evaluation of performance based on the testing R2 and RMSE suggested that the cubist model predicted total MCPD content with the highest accuracy, followed by the RF, avNNET, nnet and PLSR models. The overfitting tendency was assessed based on differences in R2 and RMSE in the training and testing calibrations. The observations showed that the cubist and avNNET models possessed a certain degree of overfitting. However, the accuracy of these models in predicting the total MCPD content was high. Results of the consensus model showed that it slightly improved the accuracy of prediction as well as significantly reduced its uncertainty. The important variables derived from the cubist and RF models suggested that the wavenumbers corresponding to the MCPDs originated from the -CH=CH2 or CH=CH (990-900 cm-1) and C-Cl stretch (800-700 cm-1) regions of the FTIR spectrum data. In short, chemometrics in combination with FTIR analysis especially for the consensus model represent a potential and flexible technique for estimating the total MCPD content of refined vegetable oils.
    Matched MeSH terms: Food Contamination
  15. Fulltext Microbiological quality evaluation of fried rice sold at food premises in Kuantan City, Pahang
    Abu Bakar A, Abdul Rafa AA, Abdullah Sani A
    International Journal of Allied Health Sciences, 2018;2(1):285-291.
    MyJurnal
    Food contamination is a crucial health problem as it could result in food-borne illness. This research aimed to evaluate the microbiological quality of ready-to-eat (RTE) fried rice dishes sold at different type of food premises in Kuantan city, Pahang. Total Plate Count (TPC), Staphylococcus aureus, Bacillus cereus and Aeromonas spp. bacteria were used as microbiological contamination indicators. About 52 samples were collected stratified randomly from four types of food premises (restaurant, cafeteria, food stall and night market) where about 13 samples were respectively collected from each type of the food premises. The results showed that TPC had medium mean count (6.30x105±1.47x105 cfu/g), S. aureus and B. cereus had high mean counts (7.70x104±2.22x105 cfu/g and 3.85x105±1.67x106 cfu/g respectively), while Aeromonas spp. had medium mean count (7.13x104±2.42x105 cfu/g). The mean counts of TPC in the samples collected from cafeteria were highest compare to other food premises.
    Matched MeSH terms: Food Contamination
  16. Fulltext Rapid investigation of α-glucosidase inhibitory activity of Phaleria macrocarpa extracts using FTIR-ATR based fingerprinting
    Easmin S, Sarker MZI, Ghafoor K, Ferdosh S, Jaffri J, Ali ME, et al.
    J Food Drug Anal, 2017 Apr;25(2):306-315.
    PMID: 28911672 DOI: 10.1016/j.jfda.2016.09.007
    Phaleria macrocarpa, known as "Mahkota Dewa", is a widely used medicinal plant in Malaysia. This study focused on the characterization of α-glucosidase inhibitory activity of P. macrocarpa extracts using Fourier transform infrared spectroscopy (FTIR)-based metabolomics. P. macrocarpa and its extracts contain thousands of compounds having synergistic effect. Generally, their variability exists, and there are many active components in meager amounts. Thus, the conventional measurement methods of a single component for the quality control are time consuming, laborious, expensive, and unreliable. It is of great interest to develop a rapid prediction method for herbal quality control to investigate the α-glucosidase inhibitory activity of P. macrocarpa by multicomponent analyses. In this study, a rapid and simple analytical method was developed using FTIR spectroscopy-based fingerprinting. A total of 36 extracts of different ethanol concentrations were prepared and tested on inhibitory potential and fingerprinted using FTIR spectroscopy, coupled with chemometrics of orthogonal partial least square (OPLS) at the 4000-400 cm-1 frequency region and resolution of 4 cm-1. The OPLS model generated the highest regression coefficient with R2Y = 0.98 and Q2Y = 0.70, lowest root mean square error estimation = 17.17, and root mean square error of cross validation = 57.29. A five-component (1+4+0) predictive model was build up to correlate FTIR spectra with activity, and the responsible functional groups, such as -CH, -NH, -COOH, and -OH, were identified for the bioactivity. A successful multivariate model was constructed using FTIR-attenuated total reflection as a simple and rapid technique to predict the inhibitory activity.
    Matched MeSH terms: Food Contamination
  17. A Limited Survey of Aflatoxins and Zearalenone in Feed and Feed Ingredients from Pakistan
    Iqbal SZ, Asi MR, Nisar S, Zia KM, Jinap S, Malik N
    J Food Prot, 2016 Oct;79(10):1798-1801.
    PMID: 28221839 DOI: 10.4315/0362-028X.JFP-16-091
    This work presents current information on the presence of aflatoxins (AFs) and zearalenone (ZEN) in feed and feed ingredients from Punjab, Pakistan. The 105 samples tested were concentrated feed, i.e., cotton seed meal (18 samples) and soybean meal (14), and feed ingredients, i.e., crushed corn (17), crushed wheat (15), barley (17). and poultry feed (24). Samples were analyzed using high-performance liquid chromatography equipped with a fluorescence detector. Analysis revealed that 69 of 105 samples were contaminated with AFs, and the highest mean concentrations of AFB1 (6.20 μg/kg) and total AFs (9.30 μg/kg) were found in poultry feed samples. The mean total AF concentrations ranged from the limit of quantification to 165.5 μg/kg. However, 75 of the 105 samples were positive for ZEN. The highest mean concentration (19.45 μg/kg) was found in poultry feed samples. The mean ZEN concentrations were 0.15 to 145.30 μg/kg. The prevalence of AFs and ZEN was high in feed and feed ingredients and needs urgent attention.
    Matched MeSH terms: Food Contamination
  18. Natural occurrence of aflatoxins and ochratoxin A in processed spices marketed in Malaysia
    Ali N, Hashim NH, Shuib NS
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2015;32(4):518-32.
    PMID: 25658149 DOI: 10.1080/19440049.2015.1011712
    The analysis of aflatoxins (B1, B2, G1 and G2) and ochratoxin A (OTA) was performed in processed spices marketed in Penang, Malaysia, using immunoaffinity columns and HPLC equipped with fluorescence detector (HPLC-FD). The processed powdered spices analysed include dried chilli, fennel, cumin, turmeric, black and white pepper, poppy seed, coriander, 'garam masala', and mixed spices for fish, meat and chicken curry. Two different studies were carried out. The limit of detection (LOD) was 0.01 ng g(-1) for each aflatoxin (AF) and 0.10 ng g(-1) for OTA (signal-to-noise ratio = 3:1). In the first study, 34 commercial processed spices analysed with a mean level, range and incidence of positive samples for total AF were 1.61 ng g(-1), 0.01-9.34 ng g(-1) and 85%, respectively, and for AFB1 were 1.38 ng g(-1), 0.01-7.68 ng g(-1) and 85%, respectively. The mean level, range and incidence of positive samples for OTA were 2.21 ng g(-1), 0.14-20.40 ng g(-1) and 79%, respectively. Natural co-occurrence of AF and OTA was found in 25 (74%) samples. In the second study of 24 commercial processed spices, the mean level, range and incidence of positive samples for total AF were 8.38 ng g(-1), 0.32-31.17 ng g(-1) and 88%, respectively, and for AFB1 were 7.31 ng g(-1), 0.32-28.43 ng g(-1) and 83%, respectively. Fifteen positive samples for total AF and two positive samples for OTA exceeded the permissible Malaysian limit of 5 ng g(-1). Contamination of both mycotoxins in spices may represent another route of exposure to consumers due to their frequent and prolonged consumption, as spices are common ingredients in popular dishes among Asian countries.
    Matched MeSH terms: Food Contamination/analysis*
  19. Use of differential scanning calorimetry to detect canola oil (Brassica napus L.) adulterated with lard stearin
    Marikkar JM, Rana S
    J Oleo Sci, 2014;63(9):867-73.
    PMID: 25174673
    A study was conducted to detect and quantify lard stearin (LS) content in canola oil (CaO) using differential scanning calorimetry (DSC). Authentic samples of CaO were obtained from a reliable supplier and the adulterant LS were obtained through a fractional crystallization procedure as reported previously. Pure CaO samples spiked with LS in levels ranging from 5 to 15% (w/w) were analyzed using DSC to obtain their cooling and heating profiles. The results showed that samples contaminated with LS at 5% (w/w) level can be detected using characteristic contaminant peaks appearing in the higher temperature regions (0 to 70°C) of the cooling and heating curves. Pearson correlation analysis of LS content against individual DSC parameters of the adulterant peak namely peak temperature, peak area, peak onset temperature indicated that there were strong correlations between these with the LS content of the CaO admixtures. When these three parameters were engaged as variables in the execution of the stepwise regression procedure, predictive models for determination of LS content in CaO were obtained. The predictive models obtained with single DSC parameter had relatively lower coefficient of determination (R(2) value) and higher standard error than the models obtained using two DSC parameters in combination. This study concluded that the predictive models obtained with peak area and peak onset temperature of the adulteration peak would be more accurate for prediction of LS content in CaO based on the highest coefficient of determination (R(2) value) and smallest standard error.
    Matched MeSH terms: Food Contamination/analysis*
  20. A comprehensive review of milk fouling on heated surfaces
    Sadeghinezhad E, Kazi SN, Dahari M, Safaei MR, Sadri R, Badarudin A
    Crit Rev Food Sci Nutr, 2015;55(12):1724-43.
    PMID: 24731003 DOI: 10.1080/10408398.2012.752343
    Heat exchanger performance degrades rapidly during operation due to formation of deposits on heat transfer surfaces which ultimately reduces service life of the equipment. Due to scaling, product deteriorates which causes lack of proper heating. Chemistry of milk scaling is qualitatively understood and the mathematical models for fouling at low temperatures have been produced but the behavior of systems at ultra high temperature processing has to be studied further to understand in depth. In diversified field, the effect of whey protein fouling along with pressure drop in heat exchangers were conducted by many researchers. Adding additives, treatment of heat exchanger surfaces and changing of heat exchanger configurations are notable areas of investigation in milk fouling. The present review highlighted information about previous work on fouling, influencing parameters of fouling and its mitigation approach and ends up with recommendations for retardation of milk fouling and necessary measures to perform the task.
    Matched MeSH terms: Food Contamination*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator ([email protected])

External Links