Displaying publications 41 - 60 of 165 in total

Abstract:
Sort:
  1. Human health risk assessment due to consumption of dried fish in Chennai, Tamil Nadu, India: a baseline report
    Priyadharshini M, Ahmed MS, Pradhoshini KP, Santhanabharathi B, Ahmed MFS, Alam L, et al.
    Environ Sci Pollut Res Int, 2024 Jun;31(29):41388-41401.
    PMID: 37171725 DOI: 10.1007/s11356-023-27339-w
    The current study sought to determine the levels of radioactivity and heavy metal contamination in 22 dried fish samples collected in Chennai, Tamil Nadu. The study found that there were substantial heavy metals concentrations for Pb, Mn, Cr, Co, and Cd. The concentration of heavy metal Pb being alarmingly high (32.85 to 42.09 mg/kg), followed by Cd (2.18 mg/kg to 3.51 mg/kg) than the permissible limit of WHO (2.17 mg/kg) for Pb and (0.05 mg/kg) for Cd. In terms of radioactivity, the gross alpha activity in the dried fish samples ranged 6.25 ± 0.12 to 48.21 ± 0.11 Bg/kg with an average of 20.35 Bg/kg and with a gross beta activity from 6.48 ± 0.02 to 479.47 ± 0.65 Bg/kg, for an average of 136.83 Bg/kg. The study found that the internal radiation dose that people receive upon consuming the fish species Sphyraena obtusata, Rachycentron canadum, Lepidocephalichthys thermalis, Synodontidae, Carangoides malabaricus, Sardina pilchardus, Scomberomorus commerson, Sillago sihama, Gerres subfasciatus, and Amblypharyngodon mola is above the ICRP-recommended limit of less than 1 mSv/year. Annual gonadal dose equivalent (AGDE) and total excessive lifetime cancer risk (ELCR) ranged 0.488 µSv year-1 and 0.004 µSv year-1 respectively, the values of AGDE being higher than the global average value. The findings of the study indicate that the analyzed dried fish samples are contaminated with Pb and Cd, which shall pose cancer risk to the consumers as a result.
    Matched MeSH terms: Food Contamination/analysis
  2. An assessment of the potential health hazards associated with metal contamination in a variety of consumable species living along the industrialized coastline of East Java, Indonesia
    Marchellina A, Soegianto A, Putranto TWC, Mukholladun W, Payus CM, Irnidayanti Y
    Mar Pollut Bull, 2024 May;202:116375.
    PMID: 38621352 DOI: 10.1016/j.marpolbul.2024.116375
    The massive industrial growth in Gresik, East Java, Indonesia has the potential to result in metal contamination in the nearby coastal waters. The purpose of this study was to analyze the metal concentrations in edible species from the Gresik coastal waters and evaluate the potential health risks linked to this metal contamination. Metal concentrations (Cu, Fe, Pb, Zn, As, Cd, Ni, Hg, and Cr) in fish and shrimp samples mostly met the maximum limits established by national and international regulatory organizations. The concentrations of As in Scatophagus argus exceed both the permissible limit established by Indonesia and the provisional tolerable weekly intake (PTWI). The As concentration in Arius bilineatus is equal to the PTWI. The target cancer risk (TCR) values for both As and Cr in all analyzed species exceed the threshold of 0.0001, suggesting that these two metals possess the potential to provide a cancer risk to humans.
    Matched MeSH terms: Food Contamination/analysis
  3. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication
    Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Food Contamination/analysis
  4. Toxicity assessment of heavy metals translocation in maize grown in the Ganges delta floodplain soils around the Payra power plant in Bangladesh
    Islam MS, Al Bakky A, Ahmed S, Islam MT, Antu UB, Saikat MSM, et al.
    Food Chem Toxicol, 2024 Nov;193:115005.
    PMID: 39284411 DOI: 10.1016/j.fct.2024.115005
    As a cereal crop, maize ranked third place after wheat and rice in terms of land area coverage for its cultivation, and in Bangladesh, it ranked second place after rice in its production. As the substitution of wheat products, maize has been used widely in baking for human consumption and animal fodder. However, maize grown in this soil around the coal-burning power plant may cause heavy metals uptake that poses a risk to humans. The study was conducted at the maize fields in the Ganges delta floodplain soils of Bangladesh to know the concentration of eight heavy metals (Ni, Cr, Cd, Mn, As, Cu, Zn, and Pb) in soil and maize samples using an inductively coupled plasma mass spectrometer (ICP-MS) and to estimate the risk of heavy metals in maize grains. Mean concentrations of heavy metals (mg/kg) in soil were in decreasing order of Zn (10.12) > Cu (10.02) > Mn (5.48) > Ni (4.95) > Cr (3.72) > As (0.51) > Pb (0.27) > Cd (0.23). The plant tissues showed the descending order of heavy metal concentration as roots > grains > stems > leaves. BCF values for As, Cd, Pb, and Mn in roots were higher than 1.0, indicating considerable accumulation of these elements in maize via roots. Total hazard quotient (ƩTHQ) of heavy metals through maize grain consumption was 3.7E+00 and 3.9E+00 for adults and children, respectively, indicating non-cancer risk to the consumers. Anthropogenic influences contributed to the heavy metals enrichment in the Ganges delta floodplain soils around the thermal plant, and potential risks (non-carcinogenic and carcinogenic) were observed due to the consumption of maize grain cultivated in the study area.
    Matched MeSH terms: Food Contamination/analysis
  5. Natural occurrence of aflatoxins and ochratoxin A in processed spices marketed in Malaysia
    Ali N, Hashim NH, Shuib NS
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2015;32(4):518-32.
    PMID: 25658149 DOI: 10.1080/19440049.2015.1011712
    The analysis of aflatoxins (B1, B2, G1 and G2) and ochratoxin A (OTA) was performed in processed spices marketed in Penang, Malaysia, using immunoaffinity columns and HPLC equipped with fluorescence detector (HPLC-FD). The processed powdered spices analysed include dried chilli, fennel, cumin, turmeric, black and white pepper, poppy seed, coriander, 'garam masala', and mixed spices for fish, meat and chicken curry. Two different studies were carried out. The limit of detection (LOD) was 0.01 ng g(-1) for each aflatoxin (AF) and 0.10 ng g(-1) for OTA (signal-to-noise ratio = 3:1). In the first study, 34 commercial processed spices analysed with a mean level, range and incidence of positive samples for total AF were 1.61 ng g(-1), 0.01-9.34 ng g(-1) and 85%, respectively, and for AFB1 were 1.38 ng g(-1), 0.01-7.68 ng g(-1) and 85%, respectively. The mean level, range and incidence of positive samples for OTA were 2.21 ng g(-1), 0.14-20.40 ng g(-1) and 79%, respectively. Natural co-occurrence of AF and OTA was found in 25 (74%) samples. In the second study of 24 commercial processed spices, the mean level, range and incidence of positive samples for total AF were 8.38 ng g(-1), 0.32-31.17 ng g(-1) and 88%, respectively, and for AFB1 were 7.31 ng g(-1), 0.32-28.43 ng g(-1) and 83%, respectively. Fifteen positive samples for total AF and two positive samples for OTA exceeded the permissible Malaysian limit of 5 ng g(-1). Contamination of both mycotoxins in spices may represent another route of exposure to consumers due to their frequent and prolonged consumption, as spices are common ingredients in popular dishes among Asian countries.
    Matched MeSH terms: Food Contamination/analysis*
  6. Use of differential scanning calorimetry to detect canola oil (Brassica napus L.) adulterated with lard stearin
    Marikkar JM, Rana S
    J Oleo Sci, 2014;63(9):867-73.
    PMID: 25174673
    A study was conducted to detect and quantify lard stearin (LS) content in canola oil (CaO) using differential scanning calorimetry (DSC). Authentic samples of CaO were obtained from a reliable supplier and the adulterant LS were obtained through a fractional crystallization procedure as reported previously. Pure CaO samples spiked with LS in levels ranging from 5 to 15% (w/w) were analyzed using DSC to obtain their cooling and heating profiles. The results showed that samples contaminated with LS at 5% (w/w) level can be detected using characteristic contaminant peaks appearing in the higher temperature regions (0 to 70°C) of the cooling and heating curves. Pearson correlation analysis of LS content against individual DSC parameters of the adulterant peak namely peak temperature, peak area, peak onset temperature indicated that there were strong correlations between these with the LS content of the CaO admixtures. When these three parameters were engaged as variables in the execution of the stepwise regression procedure, predictive models for determination of LS content in CaO were obtained. The predictive models obtained with single DSC parameter had relatively lower coefficient of determination (R(2) value) and higher standard error than the models obtained using two DSC parameters in combination. This study concluded that the predictive models obtained with peak area and peak onset temperature of the adulteration peak would be more accurate for prediction of LS content in CaO based on the highest coefficient of determination (R(2) value) and smallest standard error.
    Matched MeSH terms: Food Contamination/analysis*
  7. Sol-gel hybrid methyltrimethoxysilane-tetraethoxysilane as a new dispersive solid-phase extraction material for acrylamide determination in food with direct gas chromatography-mass spectrometry analysis
    Omar MM, Wan Ibrahim WA, Elbashir AA
    Food Chem, 2014 Sep 1;158:302-9.
    PMID: 24731346 DOI: 10.1016/j.foodchem.2014.02.045
    A sol-gel hybrid sorbent, methyltrimethoxysilane-tetraethoxysilane (MTMOS-TEOS) was successfully used as new dispersive solid phase extraction (dSPE) sorbent material in the determination of acrylamide in several Sudanese foods and analysis using GC-MS. Several important dSPE parameters were optimised. Under the optimised conditions, excellent linearity (r(2)>0.9998) was achieved using matrix matched standard calibration in the concentration range 50-1000 μg kg(-1). The limits of detection (LOD) and limit of quantification ranged from 9.1 to 12.8 μg/kg and 27.8-38.9 μg/kg, respectively. The precision (RSD%) of the method was ⩽6.6% and recoveries of acrylamide obtained were in the range of 88-103%, (n=3). The LOD obtained is comparable with the LODs of primary secondary amine dSPE. The proposed MTMOS-TEOS dSPE method is direct and safe for acrylamide analysis, showed reliable method validation performances and good cleanup effects. It was successfully applied to the analysis of acrylamide in real food samples.
    Matched MeSH terms: Food Contamination/analysis*
  8. Contamination of food samples from Malaysia with polychlorinated dibenzo-p-dioxins and dibenzofurans and estimation of human intake
    Leong YH, Chiang PN, Jaafar HJ, Gan CY, Majid MI
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2014 Apr;31(4):711-8.
    PMID: 24392728 DOI: 10.1080/19440049.2014.880519
    A total of 126 food samples, categorised into three groups (seafood and seafood products, meat and meat products, as well as milk and dairy products) from Malaysia were analysed for polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). The concentration of PCDD/Fs that ranged from 0.16 to 0.25 pg WHO05-TEQ g(-1) fw was found in these samples. According to the food consumption data from the Global Environment Monitoring System (GEMS) of the World Health Organization (WHO), the dietary exposures to PCDD/F from seafood and seafood products, meat and meat products, as well as milk and dairy products for the general population in Malaysia were 0.064, 0.183 and 0.736 pg WHO05-TEQ kg(-1) bw day(-1), respectively. However, the exposure was higher in seafood and seafood products (0.415 pg WHO05-TEQ kg(-1) bw day(-1)) and meat and meat products (0.317 pg WHO05-TEQ kg(-1) bw day(-1)) when the data were estimated using the Malaysian food consumption statistics. The lower exposure was observed in dairy products with an estimation of 0.365 pg WHO05-TEQ kg(-1) bw day(-1). Overall, these dietary exposure estimates were much lower than the tolerable daily intake (TDI) as recommended by WHO. Thus, it is suggested that the dietary exposure to PCDD/F does not represent a risk for human health in Malaysia.
    Matched MeSH terms: Food Contamination/analysis*
  9. Prevalence of nitrite and nitrate contents and its effect on edible bird nest's color
    Paydar M, Wong YL, Wong WF, Hamdi OA, Kadir NA, Looi CY
    J Food Sci, 2013 Dec;78(12):T1940-7.
    PMID: 24279333 DOI: 10.1111/1750-3841.12313
    Edible bird nests (EBNs) are important ethnomedicinal commodity in the Chinese community. Recently, But and others showed that the white EBNs could turn red by vapors from sodium nitrite (NaNO2) in acidic condition or from bird soil, but this color-changing agent remained elusive. The aim of this study was to determine the prevalence of nitrite and nitrate contents and its affects on EBN's color. EBNs were collected from swiftlet houses or caves in Southeast Asia. White EBNs were exposed to vapor from NaNO2 in 2% HCl, or bird soil. The levels of nitrite (NO2-) and nitrate (NO3-) in EBNs were determined through ion chromatography analysis. Vapors from NaNO2 in 2% HCl or bird soil stained white bird nests to brown/red colors, which correlated with increase nitrite and nitrate levels. Moreover, naturally formed cave-EBNs (darker in color) also contained higher nitrite and nitrate levels compared to white house-EBNs, suggesting a relationship between nitrite and nitrate with EBN's color. Of note, we detected no presence of hemoglobin in red "blood" nest. Using infrared spectra analysis, we demonstrated that red/brown cave-EBNs contained higher intensities of C-N and N-O bonds compared to white house-EBNs. Together, our study suggested that the color of EBNs was associated with the prevalence of the nitrite and nitrate contents.
    Matched MeSH terms: Food Contamination/analysis*
  10. Micro-solid phase extraction with liquid chromatography-tandem mass spectrometry for the determination of aflatoxins in coffee and malt beverage
    Khayoon WS, Saad B, Salleh B, Manaf NH, Latiff AA
    Food Chem, 2014 Mar 15;147:287-94.
    PMID: 24206720 DOI: 10.1016/j.foodchem.2013.09.049
    A single step extraction-cleanup procedure using porous membrane-protected micro-solid phase extraction (μ-SPE) in conjunction with liquid chromatography-tandem mass spectrometry for the extraction and determination of aflatoxins (AFs) B1, B2, G1 and G2 from food was successfully developed. After the extraction, AFs were desorbed from the μ-SPE device by ultrasonication using acetonitrile. The optimum extraction conditions were: sorbent material, C8; sorbent mass, 20mg; extraction time, 90 min; stirring speed, 1,000 rpm; sample volume, 10 mL; desorption solvent, acetonitrile; solvent volume, 350 μL and ultrasonication period, 25 min without salt addition. Under the optimum conditions, enrichment factor of 11, 9, 9 and 10 for AFG2, AFG1, AFB2 and AFB1, respectively were achieved. Good linearity and correlation coefficient was obtained over the concentration range of 0.4-50 ng g(-1) (r(2) 0.9988-0.9999). Good recoveries for AFs ranging from 86.0-109% were obtained. The method was applied to 40 samples involving malt beverage (19) and canned coffee (21). No AFs were detected in the selected samples.
    Matched MeSH terms: Food Contamination/analysis*
  11. Application of FTIR-ATR spectroscopy coupled with multivariate analysis for rapid estimation of butter adulteration
    Fadzlillah NA, Rohman A, Ismail A, Mustafa S, Khatib A
    J Oleo Sci, 2013;62(8):555-62.
    PMID: 23985484
    In dairy product sector, butter is one of the potential sources of fat soluble vitamins, namely vitamin A, D, E, K; consequently, butter is taken into account as high valuable price from other dairy products. This fact has attracted unscrupulous market players to blind butter with other animal fats to gain economic profit. Animal fats like mutton fat (MF) are potential to be mixed with butter due to the similarity in terms of fatty acid composition. This study focused on the application of FTIR-ATR spectroscopy in conjunction with chemometrics for classification and quantification of MF as adulterant in butter. The FTIR spectral region of 3910-710 cm⁻¹ was used for classification between butter and butter blended with MF at various concentrations with the aid of discriminant analysis (DA). DA is able to classify butter and adulterated butter without any mistakenly grouped. For quantitative analysis, partial least square (PLS) regression was used to develop a calibration model at the frequency regions of 3910-710 cm⁻¹. The equation obtained for the relationship between actual value of MF and FTIR predicted values of MF in PLS calibration model was y = 0.998x + 1.033, with the values of coefficient of determination (R²) and root mean square error of calibration are 0.998 and 0.046% (v/v), respectively. The PLS calibration model was subsequently used for the prediction of independent samples containing butter in the binary mixtures with MF. Using 9 principal components, root mean square error of prediction (RMSEP) is 1.68% (v/v). The results showed that FTIR spectroscopy can be used for the classification and quantification of MF in butter formulation for verification purposes.
    Matched MeSH terms: Food Contamination/analysis*
  12. Multivariate study of parameters in the determination of pesticide residues in apple by headspace solid phase microextraction coupled to gas chromatography-mass spectrometry using experimental factorial design
    Abdulra'uf LB, Tan GH
    Food Chem, 2013 Dec 15;141(4):4344-8.
    PMID: 23993624 DOI: 10.1016/j.foodchem.2013.07.022
    Solid-phase microextraction (SPME) is a solvent-less sample preparation method which combines sample preparation, isolation, concentration and enrichment into one step. In this study, multivariate strategy was used to determine the significance of the factors affecting the solid phase microextraction of pesticide residues (fenobucarb, diazinon, chlorothalonil and chlorpyrifos) using a randomised factorial design. The interactions and effects of temperature, time and salt addition on the efficiency of the extraction of the pesticide residues were evaluated using 2(3) factorial designs. The analytes were extracted with 100 μm PDMS fibres according to the factorial design matrix and desorbed into a gas chromatography-mass spectrometry detector. The developed method was applied for the analysis of apple samples and the limits of detection were between 0.01 and 0.2 μg kg(-)(1), which were lower than the MRLs for apples. The relative standard deviations (RSD) were between 0.1% and 13.37% with average recovery of 80-105%. The linearity ranges from 0.5-50 μg kg(-)(1) with correlation coefficient greater than 0.99.
    Matched MeSH terms: Food Contamination/analysis*
  13. Occurrence of Aspergillus spp. and aflatoxin B1 in Malaysian foods used for human consumption
    Reddy KR, Farhana NI, Salleh B
    J Food Sci, 2011 May;76(4):T99-104.
    PMID: 22417376 DOI: 10.1111/j.1750-3841.2011.02133.x
    Malaysian population widely consumes the cereal-based foods, oilseeds, nuts, and spices in their daily diet. Mycotoxigenic fungi are well known to invade food products under storage conditions and produce mycotoxins that have threat to human and animal health. Therefore, determining toxigenic fungi and aflatoxin B(1) (AFB1) in foods used for human consumption is of prime importance to develop suitable management strategies and to minimize risk. Ninety-five food products marketed in Penang, Malaysia were randomly collected from different supermarkets and were analyzed for presence of Aspergillus spp. by agar plate assay and AFB1 by enzyme-linked immunosorbent assay (ELISA). A. flavus was the dominant fungi in all foods followed by A. niger. Fifty-five A. flavus strains were tested for their ability to produce aflatoxins on rice grain substrate. Thirty-six (65.4%) strains out of 55 produced AFB1 ranging from 1700 to 4400 μg/kg and 17 strains (31%) produced AFB2 ranging from 620 to 1670 μg/kg. Natural occurrence of AFB1 could be detected in 72.6% food products ranging from 0.54 to 15.33 μg/kg with a mean of 1.95 μg/kg. Maximum AFB1 levels were detected in peanut products ranging from 1.47 to 15.33 μg/kg. AFB1 levels detected in all food products were below the Malaysian permissible limits (<35 μg/kg). Aspergillus spp. and AFB1 was not detected in any cookies tested. Although this survey was not comprehensive, it provides valuable information on aflatoxin levels in foods marketed in Malaysia.
    Matched MeSH terms: Food Contamination/analysis*
  14. Fulltext An optical test strip for the detection of benzoic acid in food
    Hamzah HH, Yusof NA, Salleh AB, Bakar FA
    Sensors (Basel), 2011;11(8):7302-13.
    PMID: 22164018 DOI: 10.3390/s110807302
    Fabrication of a test strip for detection of benzoic acid was successfully implemented by immobilizing tyrosinase, phenol and 3-methyl-2-benzothiazolinone hydrazone (MBTH) onto filter paper using polystyrene as polymeric support. The sensing scheme was based on the decreasing intensity of the maroon colour of the test strip when introduced into benzoic acid solution. The test strip was characterized using optical fiber reflectance and has maximum reflectance at 375 nm. It has shown a highly reproducible measurement of benzoic acid with a calculated RSD of 0.47% (n = 10). The detection was optimized at pH 7. A linear response of the biosensor was obtained in 100 to 700 ppm of benzoic acid with a detection limit (LOD) of 73.6 ppm. At 1:1 ratio of benzoic acid to interfering substances, the main interfering substance is boric acid. The kinetic analyses show that, the inhibition of benzoic is competitive inhibitor and the inhibition constant (K(i)) is 52.9 ppm. The activity of immobilized tyrosinase, phenol, and MBTH in the test strip was fairly sustained during 20 days when stored at 3 °C. The developed test strip was used for detection of benzoic acid in food samples and was observed to have comparable results to the HPLC method, hence the developed test strip can be used as an alternative to HPLC in detecting benzoic acid in food products.
    Matched MeSH terms: Food Contamination/analysis*
  15. Analysis of melamine migration from melamine food contact articles
    Chik Z, Haron DE, Ahmad ED, Taha H, Mustafa AM
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2011;28(7):967-73.
    PMID: 21607892 DOI: 10.1080/19440049.2011.576401
    Migration of melamine has been determined for 41 types of retail melamine-ware products in Malaysia. This study was initiated by the Ministry of Health, Malaysia, in the midst of public anxiety on the possibility of melamine leaching into foods that come into contact with the melamine-ware. Thus, the objective of this study was to investigate the level of melamine migration in melamine utensils available on the market. Samples of melamine tableware, including cups and plates, forks and spoons, tumblers, bowls, etc., were collected from various retail outlets. Following the test guidelines for melamine migration set by the European Committee for Standardisation (CEN 2004) with some modifications, the samples were exposed to two types of food simulants (3% acetic acid and distilled water) at three test conditions (25°C (room temperature), 70 and 100°C) for 30 min. Melamine analysis was carried out using LC-MS/MS with a HILIC column and mobile phase consisting of ammonium acetate/formic acid (0.05%) in water and ammonium acetate/formic acid (0.05%) in acetonitrile (95 : 5, v/v). The limit of quantification (LOQ) was 5 ng/ml. Melamine migration was detected from all samples. For the articles tested with distilled water, melamine migration were [median (interquartile range)] 22.2 (32.6), 49.3 (50.9), 84.9 (89.9) ng/ml at room temperature (25°C), 70 and 100°C, respectively. In 3% acetic acid, melamine migration was 31.5 (35.7), 81.5 (76.2), 122.0 (126.7) ng/ml at room temperature (25°C), 70 and 100°C, respectively. This study suggests that excessive heat and acidity may directly affect melamine migration from melamine-ware products. However the results showed that melamine migration in the tested items were well below the specific migration limit (SML) of 30 mg/kg (30,000 ng/ml) set out in European Commission Directive 2002/72/EC.
    Matched MeSH terms: Food Contamination/analysis*
  16. Fulltext Antimicrobial drug resistance of Staphylococcus aureus in dairy products
    Sasidharan S, Prema B, Yoga LL
    Asian Pac J Trop Biomed, 2011 Apr;1(2):130-2.
    PMID: 23569742 DOI: 10.1016/S2221-1691(11)60010-5
    To evaluate the prevalence of multidrug resistant Staphylococcus aureus (S. aureus) in dairy products.
    Matched MeSH terms: Food Contamination/analysis
  17. A simple and efficient multi-residue method based on QuEChERS for pesticides determination in palm oil by liquid chromatography time-of-flight mass spectrometry
    Sobhanzadeh E, Abu Bakar NK, Bin Abas MR, Nemati K
    Environ Monit Assess, 2012 Sep;184(9):5821-8.
    PMID: 21989900 DOI: 10.1007/s10661-011-2384-0
    In this study, a rapid, specific and sensitive multi-residue method based on acetonitrile extraction followed by dispersive solid-phase extraction (d-SPE) clean-up was implemented and validated for multi-class pesticide residues determination in palm oil for the first time. Liquid-liquid extraction followed by low-temperature precipitation procedure was evaluated in order to study the freezing-out clean-up efficiency to obtain high recovery yield and low co-extract fat residue in the final extract. For clean-up step, d-SPE was carried out using a combination of anhydrous magnesium sulphate (MgSO(4)), primary secondary amine, octadecyl (C(18)) and graphitized carbon black. Recovery study was performed at two concentration levels (10 and 100 ng g(-1)), yielding recovery rates between 74.52% and 97.1% with relative standard deviation values below 10% (n = 6) except diuron. Detection and quantification limits were lower than 5 and 9 ng g(-1), respectively. In addition, soft matrix effects (≤±20%) were observed for most of the studied pesticides except malathion that indicated medium (20-50%) matrix effects. The proposed method was successfully applied to the analysis of suspected palm oil samples.
    Matched MeSH terms: Food Contamination/analysis*
  18. The scenario of norovirus contamination in food and food handlers
    Tuan Zainazor C, Hidayah MS, Chai LC, Tunung R, Ghazali FM, Son R
    J Microbiol Biotechnol, 2010 Feb;20(2):229-37.
    PMID: 20208424
    Recently, many cases related to viral gastroenteritis outbreaks have been reported all over the world. Noroviruses are found to be leading as the major cause of outbreaks of acute gastroenteritis. Patients with the acute gastroenteritis normally found to be positive with norovirus when stools and vomit were analyzed. This paper reviews various activities and previous reports that describe norovirus contaminated in various food matrixes and relationship between food handlers. Lately, a numbers of norovirus outbreaks have been reported which are involved fresh produce (such as vegetables, fruits), shellfish and prepared food. Food produces by infected food handlers may therefore easily contaminated. In addition, food that required much handling and have been eaten without heat treatment gave the high risk for getting foodborne illnesses. The standard method for detection of norovirus has already been available for stool samples. However, only few methods for detection of norovirus in food samples have been developed until now.
    Matched MeSH terms: Food Contamination/analysis*
  19. Comparison of HS-SDME with SPME and SPE for the determination of eight organochlorine and organophosphorus pesticide residues in food matrices
    Kin CM, Huat TG
    J Chromatogr Sci, 2009 Sep;47(8):694-9.
    PMID: 19772747
    A headspace single-drop microextraction (HS-SDME) procedure is optimized for the analysis of organochlorine and organophosphorous pesticide residues in food matrices, namely cucumbers and strawberries by gas chromatography with an electron capture detector. The parameters affecting the HS-SDME performance, such as selection of the extraction solvent, solvent drop volume, extraction time, temperature, stirring rate, and ionic strength, were studied and optimized. Extraction was achieved by exposing 1.5 microL toluene drop to the headspace of a 5 mL aqueous solution in a 15-mL vial and stirred at 800 rpm. The analytical parameters, such as linearity, correlation coefficients, precision, limits of detection (LOD), limits of quantification (LOQ), and recovery, were compared with those obtained from headspace solid-phase microextraction (HS-SPME) and solid-phase extraction. The mean recoveries for all three methods were all above 70% and below 104%. HS-SPME was the best method with the lowest LOD and LOQ values. Overall, the proposed HS-SDME method is acceptable in the analysis of pesticide residues in food matrices.
    Matched MeSH terms: Food Contamination/analysis*
  20. Determination of the herbicide fluroxypyr in oil matrices
    Muhamad HB, Ai TY, Sahid IB
    J Environ Sci Health B, 2008 Feb;43(2):134-40.
    PMID: 18246505 DOI: 10.1080/03601230701795072
    The purpose of this study was to develop a method for the determination of fluroxypyr (4-amino-3,5-dichloro-6-fluro2-pyridyloxyacetic acid) residue in palm oil namely crude palm oil (CPO) and crude palm kernel oil (CPKO). The method involves the extraction of the herbicide from the oil matrix followed by low temperature precipitation and finally quantification of the residues using the high performance liquid chromatography (HPLC). The extraction efficiency of the method was evaluated by conducting recovery studies. The recovery of fluroxypyr from the fortified CPO samples ranged from 78%-111% with the relative values for the coefficient of variation ranging from 1.4 to 8.6%. Furthermore, the recovery of fluroxypyr from the spiked CPKO samples ranged from 91-107% with the relative values for the coefficient of variation ranging from 0.6 to 4.5%. The minimum detection limit of fluroxypyr in CPO and CPKO was 0.05 microg/g. The method was used to determine fluroxypyr residues from the field-treated samples of CPO and CPKO. When fluroxypyr was used for weed control in oil palm plantations no residue was detected in CPO and CPKO irrespective of the sampling interval and the dosage applied at the recommended or double the manufacturer's recommended dosage.
    Matched MeSH terms: Food Contamination/analysis*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator ([email protected])

External Links