MyMedR

Displaying all 5 publications

Abstract:

Sort:

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D

Open Vet J, 2024 Sep;14(9):2484-2492.
PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37

BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

Matched MeSH terms: Red Meat/analysis
Interventions of two-stage thermal sous-vide cooking on the toughness of beef semitendinosus

Ismail I, Hwang YH, Joo ST

Meat Sci, 2019 Nov;157:107882.
PMID: 31295690 DOI: 10.1016/j.meatsci.2019.107882

This paper describes the influence of different factors on toughness of beef semitendinosus (ST) by means of low temperature-long time cooking with single-stage (60 °C, 65 °C, 70 °C, and 75 °C for 6 h and 12 h) and two-stage sous-vide procedure (45 + 60 °C, 45 + 65 °C, 45 + 70 °C, and 45 + 75 °C; 49 + 60 °C, 49 + 65 °C, 49 + 70 °C, and 49 + 75 °C for 3 h at the first temperature, and either 3 or 9 h at the second temperature). Reduced toughness of ST beef steak muscle could be attained in 6 h at 60 °C and 45 + 60 °C were due from the minimum shrinkage of sarcomere as well as lower perimysial thickness, cooking loss, and elastic modulus. Collagen solubility showed a positive correlation to the toughness values. The relationship between proteolytic activity and shear force can be seen after 12 h of cooking duration. For the other quality attributes, two stepped cooking temperature-time combination seems to be more effective in preserving the redness values and water content than a single-stage sous-vide method.

Matched MeSH terms: Red Meat/analysis*
Packaging of beef fillet with active chitosan film incorporated with ɛ-polylysine: An assessment of quality indices and shelf life

Alirezalu K, Pirouzi S, Yaghoubi M, Karimi-Dehkordi M, Jafarzadeh S, Mousavi Khaneghah A

Meat Sci, 2021 Jun;176:108475.
PMID: 33684807 DOI: 10.1016/j.meatsci.2021.108475

In the current study, the effect on packaged beef fillets (1 × 5 × 8 cm) of using active chitosan film (1%) was investigated. The fillets were stored at 4 °C for 12 days, and the film contained ɛ-polylysine (ɛ-PL) (0.3, 0.6, and 0.9% w/w). Chemical, microbiological, sensory properties, and quality indices of the fillets were investigated. Added to these factors was an assessment of the influence of ɛ-polylysine incorporation on the optical, structural, barrier, and mechanical specifications (elongation at break and tensile strength) of chitosan films. Based on the findings, a significant difference among the corresponding values to thickness, color, water vapor permeability (WVP), and mechanical specifications between the treated films by ɛ-PL and untreated films were noted. In addition, higher values of thickness and tensile strength were correlated with ɛ-PL added active chitosan films while compared with control samples. Additionally, no significant differences regarding the proximate composition (including protein, moisture, and fat) among beef fillet samples were observed. In this regard, due to significantly lower levels of pH, TVB-N, and TBARS ɛ-PL in enriched films, this technique demonstrated some protective effects on beef fillets. Another observation was that lower levels of the total viable count, coliform, mold, yeasts, and higher sensory properties were significantly associated with samples with added ɛ-PL (0.9%). Therefore, adding ɛ-PL into chitosan films could be introduced as an effective technique to extend the shelf life of beef fillets and maintain their quality indices during refrigerated storage.

Matched MeSH terms: Red Meat/analysis*
Dietary supplementation of different parts of Andrographis paniculata affects the fatty acids, lipid oxidation, microbiota, and quality attributes of longissimus muscle in goats

Yusuf AL, Adeyemi KD, Roselina K, Alimon AR, Goh YM, Samsudin AA, et al.

Food Res Int, 2018 09;111:699-707.
PMID: 30007735 DOI: 10.1016/j.foodres.2018.06.015

The effects of dietary supplementation of different parts of Andrographis paniculata on fatty acids, lipid oxidation, microbiota and quality attributes of Longissimus thoracis et lumborum (LTL) muscle in goats were assessed. Twenty four, entire Boer bucks (4 months old; 20.18 ± 0.19 kg BW) were randomly allotted to either a basal diet without additive (AP0), a basal diet + 1.5% Andrographis paniculata leaves (APL) or a basal diet + 1.5% Andrographis paniculata whole plant (APW). The bucks were fed the diets for 100 d and slaughtered. The LTL muscle was subjected to a 7 d chill storage. The AP0 meat had higher (p meat. The concentrations of total C18:1trans, total CLA, C18:1n-9, C18:2n-6, C18:3n-3 and C20:5n-3 were higher (p meat than the AP0 meat. Diets had no effect (p > .05) on muscle glycogen, pH, drip loss, chemical composition and lactic acid bacteria count. Cooking loss, shear force, and TBARS values were lower (p meat compared with AP0 (26.49%, 1.13 kg, 0.23 mg MDA/kg) meat. Meat redness was higher (p meat were higher (p meat. Total viable counts and populations of Pseudomonas spp, Escherichia coli and Enterobacteriacea were higher (p meat than in APL and APW meat. The APL exhibited higher (p 

Matched MeSH terms: Red Meat/analysis*
Tetraplex PCR assay involving double gene-sites discriminates beef and buffalo in Malaysian meat curry and burger products

Hossain MA, Ali ME, Hamid SB, Hossain SM, Asing, Nizar NN, et al.

Food Chem, 2017 Jun 01;224:97-104.
PMID: 28159299 DOI: 10.1016/j.foodchem.2016.12.062

Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01ng DNA and 1% meat in admixed and burger products.

Matched MeSH terms: Red Meat/analysis*