Displaying publications 1 - 20 of 29 in total

Abstract:
Sort:
  1. Fulltext Physicochemical and sensory characteristics of burger made from duck surimi-like material
    Ramadhan K, Huda N, Ahmad R
    Poult Sci, 2012 Sep;91(9):2316-23.
    PMID: 22912469 DOI: 10.3382/ps.2011-01747
    Burgers were prepared using duck surimi-like material (DSLM) with polydextrose added (SL) and DSLM with sucrose-sorbitol added (SS), and the properties of these burgers were compared with those of burgers made of chicken meat (CB) and duck meat (DB). Quality characteristics such as chemical composition, cooking loss, diameter shrinkage, color, and texture were measured. The DB had a lower moisture content (55.58%) and higher fat content (21.44%) and cooking loss (11.01%) compared with other samples, whereas CB, SS, and SL did not differ significantly in moisture (65.21-66.10%) and fat (10.42-11.16%) content or cooking loss (5.32-6.15%). The SS and SL were positioned below CB and above DB in terms of hardness, chewiness, and springiness. Ten trained panelists assessed the burgers using quantitative descriptive analysis. Among the burgers, CB had the greatest brightness of color, hardness, springiness, and chewiness. The SS had greater sweetness than the other burgers. Both SL and SS had significantly less animalic odor, meaty flavor, oiliness, juiciness, and saltiness compared with DB. The physicochemical and sensory characteristics of burgers prepared from DSLM approached those of burgers made of chicken.
    Matched MeSH terms: Meat Products/analysis
  2. Chemical, physical and sensory properties of chicken frankfurters substituted with palm fats
    Tan SS, Aminah A, Mohd Suria Affandi Y, Atil O, Babji AS
    Int J Food Sci Nutr, 2001 Jan;52(1):91-8.
    PMID: 11225183
    Physico-chemical and sensory characteristics of frankfurters prepared with three types of palm fats (PF60: 40, PF70: 30 and PF80: 20) and palm olein (POo) at 20 and 25% of fat levels were studied. Incorporation of different fats at 20 and 25% did not affect the cooking yields of the frankfurters. Frankfurters incorporated with 25% POo showed the highest value of water-holding capacity (WHC) among eight formulations. The frankfurters containing POo showed the least cooking loss compared to those with palm fats. The incorporation of different type and level of fats resulted in significant changes in the colour (lightness, redness, yellowness) of frankfurters. Texture profiles of both raw and cooked frankfurters were found to be altered by the blending of different type and level of fats. In raw frankfurters, hardness for frankfurters mixed with palm fats were significantly higher than the one with POo but greater values for cohesiveness was observed in raw frankfurters blended with POo. Lowest chewiness was demonstrated by frankfurters mixed with 20% POo. Grilling increased the hardness values of all frankfurters. Contrary to the raw counterparts, cooked frankfurter with POo was the hardest among all formulations. Cohesiveness and chewiness was also found to be significantly higher for cooked frankfurters mixed with POo. Raw frankfurters with fat content of 25% showed greater value in hardness than those of 20%. However, there were no significant differences (P > 0.05) observed for all the texture profile attributes in cooked frankfurters due to fat levels. In sensory evaluation, frankfurters prepared with POo were found to be most acceptable by consumer panels as they scored the highest for hardness rating, chicken flavour, oiliness and overall acceptance attributes.
    Matched MeSH terms: Meat Products/analysis*
  3. Quality of mechanically deboned chicken meat frankfurter incorporated with chicken skin
    Babji AS, Chin SY, Seri Chempaka MY, Alina AR
    Int J Food Sci Nutr, 1998 Sep;49(5):319-26.
    PMID: 10367000
    Four formulations were processed into frankfurters with different ratios of mechanically deboned chicken meat (MDCM) and cooked chicken skin (CCS) i.e. 80/0, 70/10, 60/20 and 50/30. The products were evaluated for proximate composition, cholesterol content, colour; 'L' value (lightness) and 'a' value (redness), percentage of cooking loss, physical measurements (shearforce-kgf and folding test), thiobarbituric acid value (TBA) and taste panel evaluation. The increment of CCS in the frankfurters increased the contents of moisture, ash, protein, fat, cholesterol, the lightness ('L' value) and redness ('a' value). After 3 months of frozen storage, the increment continued except for the moisture contents for formulations with 20 and 30% CCS. The lipid oxidation (TBA value) and cooking loss were lowered in formulations with CCS. After 3 months of frozen storage, TBA value decreased, while the cooking loss increased for all the formulations. The addition of CCS increased hardness of the frankfurters but affected folding ability, with formulation with 10% CCS scoring better grade. Sensory evaluation was carried out using 30 untrained panelists to evaluate aroma, colour, appearance, hardness, juiciness, chicken taste, oily taste, rancid taste and overall acceptance of the products. The addition of CCS in the frankfurters at 10 and 20% resulted in products with taste and texture that were acceptable after 3 months of frozen storage.
    Matched MeSH terms: Meat Products/analysis*
  4. Halal authenticity issues in meat and meat products
    Nakyinsige K, Man YB, Sazili AQ
    Meat Sci, 2012 Jul;91(3):207-14.
    PMID: 22405913 DOI: 10.1016/j.meatsci.2012.02.015
    In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products.
    Matched MeSH terms: Meat Products/analysis*
  5. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication
    Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Meat Products/analysis
  6. Nutritional properties of spent duck surimi-like material prepared by conventional and acid-alkaline solubilization methods
    Nurkhoeriyati T, Huda N, Ahmad R
    Int J Food Sci Nutr, 2012 Jun;63(4):498-505.
    PMID: 22126368 DOI: 10.3109/09637486.2011.637902
    The nutritional properties of surimi-like materials produced from spent duck meat processed conventionally (CDS) and processed with acid and alkaline solubilization (ACDS and ALDS, respectively) were studied. The essential amino acids (EAAs) content was significantly higher (p meat, which has potential for human food uses.
    Matched MeSH terms: Meat Products/analysis*
  7. Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food
    Ali ME, Al Amin M, Hamid SB, Hossain MA, Mustafa S
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2015;32(9):1373-83.
    PMID: 26208950 DOI: 10.1080/19440049.2015.1075068
    Wider availability but lack of legal market trades has given feline meat a high potential for use as an adulterant in common meat and meat products. However, mixing of feline meat or its derivatives in food is a sensitive issue, since it is a taboo in most countries and prohibited in certain religions such as Islam and Judaism. Cat meat also has potential for contamination with of severe acute respiratory syndrome, anthrax and hepatitis, and its consumption might lead to an allergic reaction. We developed a very short-amplicon-length (69 bp) PCR assay, authenticated the amplified PCR products by AluI-restriction digestion followed by its separation and detection on a lab-on-a-chip-based automated electrophoretic system, and proved its superiority over the existing long-amplicon-based assays. Although it has been assumed that longer DNA targets are susceptible to breakdown under compromised states, scientific evidence for this hypothesis has been rarely documented. Strong evidence showed that shorter targets are more stable than the longer ones. We confirmed feline-specificity by cross-challenging the primers against 10 different species of terrestrial, aquatic and plant origins in the presence of a 141-bp site of an 18S rRNA gene as a universal eukaryotic control. RFLP analysis separated 43- and 26-bp fragments of AluI-digest in both the gel-image and electropherograms, confirming the original products. The tested detection limit was 0.01% (w/w) feline meat in binary and ternary admixed as well as meatball matrices. Shorter target, better stability and higher sensitivity mean such an assay would be valid for feline identification even in degraded specimens.
    Matched MeSH terms: Meat Products/analysis*
  8. Effect of non-meat proteins, soy protein isolate and sodium caseinate, on the textural properties of chicken bologna
    Yusof SC, Babji AS
    Int J Food Sci Nutr, 1996 Jul;47(4):323-9.
    PMID: 8844254
    Nine formulations were processed into bologna with different ratios of soy protein isolate (SPI):sodium caseinate (SCA), i.e. 1:1, 1:2.5, 1:5, 5:1, 5:2.5, 5:5, 10:1, 10:2.5 and 10:5. The products were evaluated for yields, emulsion stability, physical measurements (shearforce-kgf and folding test) and taste panel evaluation. Formulations with 5:1 and 5:5 SPI:SCA had lower liquid loss resulting in higher yields while the others had poor emulsion stability and high liquid loss. Firmer texture was exhibited by formulations 1:1, 5:1 and 10:1 SPI:SCA but formulation with 1:1 SPI:SCA showed better gelation followed by 1:2.5, 1:5, 5:1, and 5:2.5. The other formulations had poor gelation and binding properties, especially formulation with 10:5 SPI:SCA. Sensory evaluation was carried out using 30 untrained panelists. Attributes evaluated were aroma, texture, chewiness, juiciness, saltiness, chicken taste and overall acceptance. Formulation with 5:1 SPI:SCA was more acceptable for texture, chicken taste and overall acceptance while formulation with 1:1 SPI:SCA was more acceptable for the chewiness, juiciness and saltiness attributes. There was no significant difference (P > 0.05) in aroma attribute, for all formulations.
    Matched MeSH terms: Meat Products/analysis
  9. Rapid identification of pork for halal authentication using the electronic nose and gas chromatography mass spectrometer with headspace analyzer
    Nurjuliana M, Che Man YB, Mat Hashim D, Mohamed AK
    Meat Sci, 2011 Aug;88(4):638-44.
    PMID: 21420795 DOI: 10.1016/j.meatsci.2011.02.022
    The volatile compounds of pork, other meats and meat products were studied using an electronic nose and gas chromatography mass spectrometer with headspace analyzer (GCMS-HS) for halal verification. The zNose™ was successfully employed for identification and differentiation of pork and pork sausages from beef, mutton and chicken meats and sausages which were achieved using a visual odor pattern called VaporPrint™, derived from the frequency of the surface acoustic wave (SAW) detector of the electronic nose. GCMS-HS was employed to separate and analyze the headspace gasses from samples into peaks corresponding to individual compounds for the purpose of identification. Principal component analysis (PCA) was applied for data interpretation. Analysis by PCA was able to cluster and discriminate pork from other types of meats and sausages. It was shown that PCA could provide a good separation of the samples with 67% of the total variance accounted by PC1.
    Matched MeSH terms: Meat Products/analysis*
  10. Analysis of pork adulteration in commercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by TaqMan probe real-time polymerase chain reaction
    Ali ME, Hashim U, Mustafa S, Che Man YB, Dhahi TS, Kashif M, et al.
    Meat Sci, 2012 Aug;91(4):454-9.
    PMID: 22444666 DOI: 10.1016/j.meatsci.2012.02.031
    A test for assessing pork adulteration in meatballs, using TaqMan probe real-time polymerase chain reaction, was developed. The assay combined porcine-specific primers and TaqMan probe for the detection of a 109 bp fragment of porcine cytochrome b gene. Specificity test with 10 ng DNA of eleven different species yielded a threshold cycle (Ct) of 15.5 ± 0.20 for the pork and negative results for the others. Analysis of beef meatballs with spiked pork showed the assay can determine 100-0.01% contaminated pork with 102% PCR efficiency, high linear regression (r(2) = 0.994) and ≤ 6% relative errors. Residuals analysis revealed a high precision in all determinations. Random analysis of commercial meatballs from pork, beef, chicken, mutton and goat, yielded a Ct between 15.89 ± 0.16 and 16.37 ± 0.22 from pork meatballs and negative results from the others, showing the suitability of the assay to determine pork in commercial meatballs with a high accuracy and precision.
    Matched MeSH terms: Meat Products/analysis*
  11. Color, sensory and textural attributes of beef frankfurter, beef ham and meat-free sausage containing tomato pomace
    Savadkoohi S, Hoogenkamp H, Shamsi K, Farahnaky A
    Meat Sci, 2014 Aug;97(4):410-8.
    PMID: 24769097 DOI: 10.1016/j.meatsci.2014.03.017
    The present investigation focuses on the textural properties, sensory attributes and color changes of beef frankfurter, beef ham and meat-free sausage produced by different levels of bleached tomato pomace. The texture and color profile were performed using an instrumental texture analyzer and colorimeter. The findings indicated that tomato pomace-added sausages had higher water holding capacity (WHC) compared to that of commercial samples. The frankfurters containing 5 and 7% (w/w) tomato pomace had the highest redness (a*), chroma (C*) and color differences (ΔE) values, while the meat-free sausages containing 7% (w/w) tomato pomace had significant (p<0.05) values for lightness (L*) and yellowness (b*). Furthermore, there were no significant (p>0.05) color differences between beef ham samples (with and without tomato pomace). A significant progression in the textural hardness and chewiness of systems containing tomato pomace was observed as well as higher sensory scores by panelists. According to sensorial evaluations, bleached tomato pomace improved the consumer acceptability and preference.
    Matched MeSH terms: Meat Products/analysis*
  12. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation
    Rahman MM, Ali ME, Hamid SB, Mustafa S, Hashim U, Hanapi UK
    Meat Sci, 2014 Aug;97(4):404-9.
    PMID: 24769096 DOI: 10.1016/j.meatsci.2014.03.011
    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods.
    Matched MeSH terms: Meat Products/analysis*
  13. Fruiting-body-base flour from an Oyster mushroom waste in the development of antioxidative chicken patty
    Wan-Mohtar WAAQI, Halim-Lim SA, Kamarudin NZ, Rukayadi Y, Abd Rahim MH, Jamaludin AA, et al.
    J Food Sci, 2020 Oct;85(10):3124-3133.
    PMID: 32860235 DOI: 10.1111/1750-3841.15402
    In a commercial oyster mushroom farm, from 300 g of the total harvest, only the cap and stem of the fruiting body parts are harvested (200 g) while the unused lower section called fruiting-body-base (FBB) is discarded (50 g). A new antioxidative FBB flour (FBBF) conversion to mixed-ratio chicken patty was recently developed which converts 16.67% of FBB into an edible flour. At the initial stage, pretreatments of FBBF were optimized at particle size (106 µm) and citric acid concentration (0.5 g/100 mL) to improve flour antioxidant responses. Such pretreatments boosted total phenolic content (2.31 ± 0.53 mg GAE/g) and DPPH (51.53 ± 1.51%) of pretreated FBBF. Mixed-ratio chicken patty containing FBBF (10%, 20%, 30%) significantly (P
    Matched MeSH terms: Meat Products/analysis*
  14. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain
    Hossain MAM, Ali ME, Sultana S, Asing, Bonny SQ, Kader MA, et al.
    J Agric Food Chem, 2017 May 17;65(19):3975-3985.
    PMID: 28481513 DOI: 10.1021/acs.jafc.7b00730
    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
    Matched MeSH terms: Meat Products/analysis
  15. Current analytical methods for porcine identification in meat and meat products
    Zia Q, Alawami M, Mokhtar NFK, Nhari RMHR, Hanish I
    Food Chem, 2020 Sep 15;324:126664.
    PMID: 32380410 DOI: 10.1016/j.foodchem.2020.126664
    Authentication of meat products is critical in the food industry. Meat adulteration may lead to religious apprehensions, financial gain and food-toxicities such as meat allergies. Thus, empirical validation of the quality and constituents of meat is paramount. Various analytical methods often based on protein or DNA measurements are utilized to identify meat species. Protein-based methods, including electrophoretic and immunological techniques, are at times unsuitable for discriminating closely related species. Most of these methods have been replaced by more accurate and sensitive detection methods, such as DNA-based techniques. Emerging technologies like DNA barcoding and mass spectrometry are still in their infancy when it comes to their utilization in meat detection. Gold nanobiosensors have shown some promise in this regard. However, its applicability in small scale industries is distant. This article comprehensively reviews the recent developments in the field of analytical methods used for porcine identification.
    Matched MeSH terms: Meat Products/analysis*
  16. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products
    Hossain MA, Ali ME, Abd Hamid SB, Asing, Mustafa S, Mohd Desa MN, et al.
    J Agric Food Chem, 2016 Aug 17;64(32):6343-54.
    PMID: 27501408 DOI: 10.1021/acs.jafc.6b02224
    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials.
    Matched MeSH terms: Meat Products/analysis*
  17. Frozen storage stability of beef patties incorporated with extracts from ulam raja leaves (Cosmos caudatus)
    Reihani SF, Tan TC, Huda N, Easa AM
    Food Chem, 2014 Jul 15;155:17-23.
    PMID: 24594148 DOI: 10.1016/j.foodchem.2014.01.027
    In Malaysia, fresh ulam raja leaves (Cosmos caudatus) are eaten raw with rice. In this study, beef patties incorporated with extracts of ulam raja (UREX) and commercial green tea extract (GTE) added individually at 200 and 500 mg/kg were stored at -18°C for up to 10 weeks. Lipid oxidation, cooking yield, physicochemical properties, textural properties, proximate composition and sensory characteristics of the beef patties were compared between those incorporated with UREX, GTE and the control (pure beef patty). Incorporation of UREX or GTE at 500 mg/kg into beef patties reduced the extent of lipid oxidation significantly (P<0.05). UREX showed a strong lipid oxidation inhibitory effect, comparable with GTE. In addition, a significant improvement (P<0.05) in cooking yield and textural properties was also recorded. However, incorporation of UREX and GTE into beef patties showed no significant influence (P>0.05) on the colour, pH, proximate composition and overall sensory acceptability of the patties.
    Matched MeSH terms: Meat Products/analysis*
  18. Effect of retorting and oven cooking on the nutritional properties of beef frankfurters blended with palm oils
    Wan Rosli WI, Babji AS, Aminah A, Foo SP, Abd Malik O
    Int J Food Sci Nutr, 2010 Aug;61(5):519-35.
    PMID: 20166846 DOI: 10.3109/09637481003591582
    The effect of retorting and oven cooking on the nutritional properties of beef frankfurters blended with palm oil (PO), red PO35 and red PO48 were compared against the control beef fat treatment. Red PO oven-cooked beef frankfurters resulted in a significant loss of vitamin E from 538.5 to 287.5 microg after 6 months. Oven cooked sausages stored at -18 degrees C and retorted sausages stored for the 6 months of shelf studies resulted in more than 90% loss of alpha-carotene and beta-carotene in red PO beef frankfurters. Cholesterol was reduced at the range of 29.0-32.2 mg/100 g when beef fat was substituted with palm-based oils, in beef frankfurters. Differences of heat treatments did not significantly change THE cholesterol content, within all treatments. This study showed the potential of utilizing red palm oils as animal fat analogues in improving vitamin E, reducing cholesterol but not carotenes in beef frankfurters.
    Matched MeSH terms: Meat Products/analysis*
  19. Genetic diversity, virulotyping and antimicrobial resistance susceptibility of Yersinia enterocolitica isolated from pigs and porcine products in Malaysia
    Thong KL, Tan LK, Ooi PT
    J Sci Food Agric, 2018 Jan;98(1):87-95.
    PMID: 28542807 DOI: 10.1002/jsfa.8442
    BACKGROUND: The objectives of the present study were to determine the antimicrobial resistance, virulotypes and genetic diversity of Yersinia enterocolitica isolated from uncooked porcine food and live pigs in Malaysia.

    RESULTS: Thirty-two non-repeat Y. enterocolitica strains of three bioserotypes (3 variant/O:3, n = 27; 1B/O:8, n = 3; 1A/O:5, n = 2) were analysed. Approximately 90% of strains were multidrug-resistant with a multiple antibiotic resistance index < 0.2 and the majority of the strains were resistant to nalidixic acid, clindamycin, ampicillin, ticarcillin, tetracycline and amoxicillin. Yersinia enterocolitica could be distinguished distinctly into three clusters by pulsed-field gel electrophoresis, with each belonging to a particular bioserotype. Strains of 3 variant/O:3 were more heterogeneous than others. Eleven of the 15 virulence genes tested (hreP, virF, rfbC, myfA, sat, inv, ail, ymoA, ystA, tccC, yadA) and pYV virulence plasmid were present in all the bioserotpe 3 variant/03 strains.

    CONCLUSION: The occurrence of virulent strains of Y. enterocolitica in pigs and porcine products reiterated that pigs are important reservoirs for Y. enterocolitica. The increasing trend of multidrug resistant strains is a public health concern. This is the first report on the occurrence of potential pathogenic and resistant strains of Y. enterocolitica in pigs in Malaysia. © 2017 Society of Chemical Industry.

    Matched MeSH terms: Meat Products/analysis
  20. Duplex real-time PCR assay using SYBR Green to detect and quantify Malayan box turtle (Cuora amboinensis) materials in meatballs, burgers, frankfurters and traditional Chinese herbal jelly powder
    Asing, Ali E, Hamid SB, Hossain M, Ahamad MN, Hossain SM, et al.
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2016 Nov;33(11):1643-1659.
    PMID: 27643977
    The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected species widely used in exotic foods and traditional medicines. Currently available polymerase chain reaction (PCR) assays to identify MBT lack automation and involve long targets which break down in processed or denatured tissue. This SYBR Green duplex real-time PCR assay has addressed this research gap for the first time through the combination of 120- and 141-bp targets from MBT and eukaryotes for the quantitative detection of MBT DNA in food chain and herbal medicinal preparations. This authentication ensures better security through automation, internal control and short targets that were stable under the processing treatments of foods and medicines. A melting curve clearly demonstrated two peaks at 74.63 ± 0.22 and 78.40 ± 0.31°C for the MBT and eukaryotic products, respectively, under pure, admixed and commercial food matrices. Analysis of 125 reference samples reflected a target recovery of 93.25-153.00%, PCR efficiency of 99-100% and limit of detection of 0.001% under various matrices. The quantification limits were 0.00001, 0.00170 ± 0.00012, 0.00228 ± 0.00029, 0.00198 ± 0.00036 and 0.00191 ± 0.00043 ng DNA for the pure meat, binary mixtures, meatball, burger and frankfurter products, respectively. The assay was used to screen 100 commercial samples of traditional Chinese herbal jelly powder from eight different brands; 22% of them were found to be MBT-positive (5.37 ± 0.50-7.00 ± 0.34% w/w), which was reflected through the Ct values (26.37 ± 0.32-28.90 ± 0.42) and melting curves (74.63-78.65 ± 0.22°C) of the amplified MBT target (120 bp), confirming the speculation that MBT materials are widely used in Chinese herbal desserts, exotic dishes consumed with the hope of prolonging life and youth.
    Matched MeSH terms: Meat Products/analysis*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator ([email protected])

External Links